Chapters

SECTION 1 - DEFINITIONS AND GENERAL PRINCIPLES

Codified File

General remarks

OIV-MA-AS1-02 General remarks

Clear wine or must, must be used for chemical and physical analysis. If the wine or the must is cloudy, it is first filtered through filter paper in a covered funnel or centrifuged in a closed container. This operation must be stated on any required documentation.

The reference of the method employed for each determination must be on any required documentation.

Units of measure for the various magnitudes (volume, mass, concentration, temperature, pressure, etc.) shall be in accordance with the recommendations of the IUPAC (International Union for Pure and Applied Chemistry).

In respect of reagents and titration solutions used, unless otherwise required in the text, the chemicals used are to be of "analytical grade" and the water is to be distilled or of equivalent purity.

Enzyme methods, and the determination of a number of parameters, are to be based on absolute measurements of absorbance, which requires spectrophotometers to be calibrated for wavelengths and absorbance. Wavelength may be calibrated by use of Hg lines: 239.94, 248.0, 253.65, 280.4, 302.25, 313.16, 334.15, 365.43, 404.66, 435.83, 546.07, 578.0, and 1014.0 nm. Absorbance may be calibrated by means of commercial reference solutions, obtained from suitable suppliers, or neutral density filters.

The essential bibliographical references are given. The references to working documents of the Sub‑Commission are marked 'F.V., O.I.V.' (feuillets verts or 'green pages'), followed by the year of publication and the number of the document.

Classification of analytical methods

OIV-MA-AS1-03 Classification of analytical methods

CATEGORY I* (CRITERION BENCHMARK METHOD): A method which determines a value that can be arrived at only by implementing the method per se and which serves, by definition, as the only method for establishing the accepted value of the parameter measured (e.g., alcoholometric content, total acidity, volatile acidity).

CATEGORY II* (BENCHMARK METHOD): A category II method is designated as the Benchmark Method in cases where category I methods cannot be used. It should be selected from category III methods (as defined below). Such methods should be recommended for use in cases of disputes and for calibration purposes. (e.g., potassium, citric acid).

CATEGORY III* (APPROVED ALTERNATIVE METHODS): A category III Method meets all of the criteria specified by the Sub-Committee on Methods of Analysis and is used for monitoring, inspection and regulatory purposes (e.g., enzymatic determinations of glucose and fructose).

CATEGORY IV (AUXILIARY METHOD): A category IV Method is a conventional or recently-implemented technique, with respect to which the Sub-Committee on Methods of Analysis has not as yet specified the requisite criteria (e.g., synthesized coloring agents, measurement of oxidation-reduction potential).

* Methods requiring formal approval in accordance with the procedures in force at the Sub-Commission of Methods of Analysis.

Matrix effect for metals content analysis using atomic absorption

OIV-MA-AS1-04 Matrix effect for metals content analysis using atomic absorption

The GENERAL ASSEMBLY,

In consideration of Article 5, Paragraph 4 of the International Standardization Convention on Methods of Wine Analysis and Rating of October 13, 1954,

Action on the proposal of the Sub-Committee on International Methods of Analysis and Rating of Wines,

CONSIDERING that the methods described in the Compendium of International Methods of Wine and Must Analysis and entailing the use of reference solutions are implemented for dry wines,

DRAWS the attention of users to the fact that deviations may be observed in other cases involving the presence of sugars or sugar derivatives,

DECIDES that it is therefore necessary to undertake analyses using the quantified additions method. A minimum of three aliquot portions of the sample containing various additions should be used.

DECIDES to supplement the methods for analyzing metals (iron, lead, zinc, silver, cadmium) and arsenic with a description of the quantified additions technique, when the matrix effect so requires.

Provisions on the use of proprietary methods that should be adopted by the OIV

OIV-MA-AS1-05a Provisions on the use of proprietary methods that should be adopted by the OIV

Definition of a Proprietary Method of Analysis

For OIV purposes, a proprietary method of analysis is one that contains protected intellectual property preventing full disclosure of information about the method and/or where the intellectual property owner restricts the use or distribution of the method or materials for its performance such that no alternative source of these would be available. It does not extend to a method which is subject only to copyright.

Requirements

The OIV requires the method sponsors to provide relevant data to enable the SCMA (“Methods of Analysis” Sub-Commission) or another expert group to carry out an assessment. Following assessment, the SCMA, or another expert group, may submit methods of analysis that are proprietary, or are based on proprietary aspects, to the OIV General Assembly, for their approval, according to the following procedures.

a) A proprietary method should not be endorsed if a suitable non-proprietary method of analysis is available that has been or could be endorsed and that has similar or better performance characteristics. This should ensure that no approach is taken that could suggest that a proprietary method is endorsed by the OIV to the detriment of other potential methods; where possible preference should be given to adopting appropriate method criteria rather than endorsing a specific proprietary method of analysis.

b) Whilst respecting the necessity for reasonable protection of intellectual property, sufficient information should be available to enable reliable use of the method by analysts and to enable evaluation of the performance of the method by the SCMA or another expert group. In particular cases this may extend beyond performance data, for example, including details of the operating principle, at the sole discretion of the SCMA or another expert group.

c) Preference should be given to endorsing those methods of analysis where the reagents and/or apparatus are described in the method, to the extent that either laboratories or other manufacturers could produce these themselves; alternatively, details enabling them to acquire these themselves would also suffice.

d) Method performance criteria required for proprietary methods are the same as those for non-proprietary methods. The performance criteria should be those stipulated above. If appropriate, information about the effect of variability of the reagents used should be provided.

e) After endorsing, any changes that may influence performance characteristics must be reported to the SCMA or another expert group for consideration.

f) A method with some parts that constitute protected proprietary information should be fully and collaboratively validated according to the OIV standards appearing in Annex A of the Compendium of International Methods of Analysis of Wines and Musts. The results of such studies will be made available for the SCMA or another expert group.

g) The manufacturer or the party submitting for evaluation a proprietary method should demonstrate to the satisfaction of the SCMA or another expert group that the fundamental principles and characteristics for the execution of the method may be made available to all interested parties.

h) The SCMA or another expert group may decline to assess a proprietary method if intellectual property restrictions unduly limit research into determining the method properties, scope and validity or development of improvements to the technology.

i) If suitable non-proprietary methods become available and endorsed, the status of the previously endorsed proprietary method should be reviewed and revised if necessary.

SECTION 2 - PHYSICAL ANALYSIS

Codified File

Density and Specific Gravity at 20°C (Type-I-and-IV)

OIV-MA-AS2-01 Density and specific gravity at 20°C

Type I and IV methods

Scope of application

This resolution is applicable for determining the density and specific gravity at 20 °C of wines and musts, using any of the following:

Pycnometry: Type I Method,
Electronic densimetry using a frequency oscillator: Type I Method,
Densimetry using a hydrostatic balance: Type I Method,
Hydrometry: Type IV Method.

Definition

Density is the quotient of the mass of a certain volume of wine or must at 20 °C by this volume. It is expressed in g/cm³ and its symbol is ρ_20°C.

The specific gravity is the ratio of the density of a substance to the density of a reference material. For the analysis of wine or must, it is typically expressed as the ratio of the density of the wine or must at 20 °C to the density of water at 20 °C. Its symbol is:

Note: It is possible to obtain the specific gravity from the density ρ₂₀ at 20 °C:

ρ₂₀ = 0.998203 x or = ρ₂₀ /0.998203 (where 0.998203 is the density of water at 20 °C in g/ cm³)

Principle of the methods

The principle of each method is detailed in the following parts:

Method A: Pycnometry

Method B: Electronic densimetry using a frequency oscillator

Method C: Densimetry using a hydrostatic balance

Method D: Hydrometry

Note: For very precise determinations, the density should be corrected to account for sulphur-dioxide action.

ρ₂₀ (g/cm3)= ρ'₂₀ - 0.0006 × S

ρ₂₀ (g/cm3) = corrected density

ρ'₂₀ (g/cm3) = observed density

S (g/L) = total sulphur dioxide

Preliminary sample preparation

If the wine or must contains notable quantities of carbon dioxide, remove the grand majority by, for example, mixing 250 mL of sample in a 1000-mL vial, or by filtering under reduced pressure on 2 g of cotton placed in an extension tube, or by any other suitable method.

Method A: Density at 20 °C and specific gravity at 20 °C measured by pycnometry (Type method)

A.1. Principle

The density of the wine or must is measured for a specific temperature using a glass pycnometer. This comprises a flask of known capacity, onto which a hollow ground-glass stopper is fitted equipped with a capillary tube. When the flask is closed, the overflow rises in the capillary. The volumes of the flask and the capillary being known, the density is determined by weighing using precision balances before and after filling of the pycnometer.

A.2. Reagents and products

A.2.1. Type II water for analytical use (ISO 3696 standard), or of equivalent purity

A.2.2. Sodium chloride solution (2% m/v)

To prepare 1 litre, weigh out 20 g of sodium chloride and dissolve to volume in water.

A.3. Apparatus and materials

Current laboratory apparatus, including the following:

A.3.1. Pyrex-glass pycnometer of around 100 mL capacity with a removable thermometer, with ground-glass joint and 10^th-of-a-degree graduations, from 10 °C to 30 °C. This thermometer should be calibrated (Fig. 1).

Any pycnometer of equivalent characteristics may be used.

FIGURE 1: Pycnometer and its tare bottle

This pycnometer includes a side tube of 25 mm in length and an inside diameter of at most 1 mm, terminated by a ground-glass conical joint. This side tube may be capped by a 'reservoir stopper' composed of a ground-glass conical tube, terminated by a tapered joint. This stopper serves as an expansion chamber.

The two joints of the apparatus should be prepared with great care.

A.3.2. Tare bottle of the same external volume (to within 1 mL) as the pycnometer and with a mass equal to the mass of the pycnometer filled with a liquid of a density of 1.01 g/mL (sodium chloride solution at 2% m/v)

A.3.3. Thermally insulated jacket that fits the body of the pycnometer exactly.

A.3.4. Twin-pan balance accurate to the nearest 0.1 mg

single-plate balance accurate to the nearest 0.1 mg.

A.3.5. Masses calibrated by an accredited body

A.4. Procedure

A.4.1. Pycnometer calibration

The calibration of the pycnometer comprises the determination of the following characteristics:

tare weight,
volume at 20 °C,
water mass at 20 °C.
1. Using a twin-pan balance

Place the tare bottle on the left-hand pan and the clean, dry pycnometer with its 'reservoir stopper' on the right-hand pan. Balance them by placing weights of known mass on the pycnometer side: p grams.

Fill the pycnometer carefully with water (A.2.1) at room temperature and fit the thermometer.

Carefully wipe the pycnometer dry and place it in the thermally insulated jacket.

Shake by inverting the container until the thermometer's temperature reading is constant, accurately adjust the level to the upper rim of the side tube, wipe the side tube clean and fit the reservoir stopper.

Read the temperature, t °C, carefully and if necessary correct for any inaccuracies in the temperature scale.

Weigh the water-filled pycnometer, with the weight in grams, p', making up the equilibrium.

Calculations:

Tare of the empty pycnometer:

Tare weight = p + m where m (g) = mass of the air contained in the pycnometer

m (g) = 0.0012 (p - p’)

Volume at 20 °C in mL:

(mL) = (p + m - p') x

= factor for temperature, t°C, taken from Table I

should be known to ± 0.001 mL

Water mass at 20 °C:

(g) = x 0.998203
0.998203 (g/cm³) = water density at 20 °C
1. Using a single-pan balance

Determine:

the mass of the clean, dry pycnometer: P,
the mass of the water-filled pycnometer at t °C: P₁ following the instructions outlined in A.4.1.1,
the mass of the tare bottle, .

Calculations:

Tare of the empty pycnometer:

Tare weight: P – m where m (g) = mass of the air contained in the pycnometer

m (g) = 0.0012 ( - P)

Volume at 20 °C in mL:

(mL) = [P1 ‑ (P ‑ m)] x

= factor for temperature, t°C, taken from Table I

should be known to 0.001 mL

Water mass at 20°C:

(g) = x 0.998203
0.998203 = water density at 20 °C ( g/cm³)

A.4.2. Determination of the density:

A.4.2.1. Using a twin-pan balance

Weigh the pycnometer filled with the test sample following the instructions outlined in A.4.1.1.

Where p" represents the mass in grams that makes up the equilibrium at t°C,

taking into account that the liquid mass contained in the pycnometer = p + m - p", the apparent density at t°C, in g/cm³, is given by the following equation:

Calculate the density at 20 °C using one of the following correction tables in Annex I, according to the nature of the liquid to be analysed and the type ofpycnometer to be used: dry wine and dealcoholized wine (Table II or V), natural or concentrated must (Table III or VI), or liqueur wine (Table IV or VII).

A.4.2.2. Using a single-pan balance

Weigh the tare bottle, where T₁ is its mass in g.

Calculate dT =

Mass of the empty pycnometer at the time of measurement = P - m + dT in g

Weigh the pycnometer filled with the test sample following the instructions outlined in A.4.1.1.

Where P₂represents its mass at t°C,

the liquid mass contained in the pycnometer at t°C = (P - m + dT) in g

and the apparent density at °C, in g/cm³, is as follows

Calculate the density at 20°C of the liquid to be analysed: dry wine, natural or concentrated must, or liqueur wine, as indicated in A.4.2.1.

A.5. Expression of results

The density is expressed in g/cm³ to 5 decimal places.

A.6. Precision

A.6.1. Repeatability in terms of density:

for dry and sweet wines, except liqueur wines: r = 0.00010 g/cm³,
for liqueur wines: r = 0.00018 g/ cm³.
1. Reproducibility in terms of density:

for dry and sweet wines, except liqueur wines: R = 0.00037 g/cm³,
for liqueur wines: R = 0.00045 g/cm³.

A.7. Numerical example

A.7.1. Measurement by pycnometer on a twin-pan balance

A/Calibration of the pycnometer

1. Weighing of the clean, dry pycnometer:

Tare = pycnometer + p

ρ = 104.9454 g

2. Weighing of the water-filled pycnometer at the temperature t°C:

Tare = pycnometer + water + p'
p' = 1.2396 g for t = 20.5 °C

3. Calculation of the mass of the air contained in the pycnometer:

m = 0.0012 (p ‑ p’)
m = 0.0012 (104.9454 – 1.2396)
m = 0.1244

4.Parameters to be kept:

Tare of the empty pycnometer: p + m
p + m = 104.9454 + 0.1244
p + m = 105.0698 g
Volume at 20 °C = (p + m ‑ p') x
= 1.001900
= (105.0698 – 1.2396) x 1.001900
= 104.0275 mL
Water mass at 20°C = x 0.998203
= 103.8405 g

B/ Determination of the density at 20°C and the 20°C/20°C specific gravity of a dry wine:

p' = 1.2622 g at 17.80 °C

ρ_{17.80 °C} = 0.99788 g/cm³

Table II makes it possible to calculate ρ₂₀_°C from ρ_t _°Cusing the following formula:

For t = 17.80 °C and for an alcoholic strength of 11% vol., c = 0.54:

A.7.1.2. Measurement by pycnometer on a single-pan balance

A/ Establishment of the pycnometer constants

1.Weighing of the clean, dry pycnometer:

P = 67.7913 g

2. Weighing of the water-filled pycnometer at t°C:

= 169.2715 g at 21.65°C

3.Calculation of the mass of the air contained in the pycnometer:

m = 0.0012 (P1 ‑ P)
m = 0.0012 x 101.4802
m = 0.1218 g

4. Characteristics to be retained:

Tare of the empty pycnometer: P – m
P - m = 67.7913 – 0.1218
P - m = 67.6695 g
Volume at 20 °C = [P₁ - (P - m)] x
= 1.002140
= (169.2715 – 67.6695) x 1.002140
= 101.8194 mL
Water mass at 20 °C: x 0.998203
= 101.6364 g
Mass of the tare bottle:
= 171.9160 g

B/Determination of the density at 20 °C and 20 °C/20 °C specific gravity of a dry wine:

= 171.9178

dT = 171.9178 – 171.9160 = 0.0018 g

P - m + dT = 67.6695 + 0.0018 = 67.6713 g

= 169.2799 at 18°C

A.7.2. Measurement by pycnometer on a single-pan balance

A/ Establishment of the pycnometer constants

1. Weighing of the clean, dry pycnometer:

P = 67.7913 g

2. Weighing of the water-filled pycnometer at t °C:

= 169.2715 g at 21.65°C

3. Calculation of the mass of the air contained in the pycnometer:

m = 0.0012 (P1 ‑ P)
m = 0.0012 x 101.4802
m = 0.1218 g

4. Characteristics to be retained:

Tare of the empty pycnometer: P – m
P - m = 67.7913 – 0.1218
P - m = 67.6695 g
Volume at 20 °C = [P₁ - (P - m)] x
= 1.002140
= (169.2715 – 67.6695) x 1.002140
= 101.8194 mL
Water mass at 20°C: x 0.998203
M₂₀_°C = 101.6364 g
Mass of the tare bottle:
= 171.9160 g

B/ Determination of the density at 20 °C and 20 °C/20 °C specific gravity of a dry wine:

= 171.9178
dT = 171.9178 – 171.9160 = 0.0018 g
P - m + dT = 67.6695 + 0.0018 = 67.6713 g
= 169.2799 at 18°C

Method B:Density at 20 °C and specific gravity at 20 °C measured by electronic densimetry using a frequency oscillator (Type I method)

B.1. Principle

The density of the wine or must is measured by electronic densimetry using a frequency oscillator. The principle consists of measuring the period of oscillation of a tube containing the sample undergoing electromagnetic stimulation. The density is related to the period of oscillation by the following formula:

ρ = density of the sample

T = period of induced vibration

M = mass of empty tube

C = spring constant

V = volume of vibrating sample

This relationship is in the form ρ = A – B(2), so there is a linear relationship between the density and the period squared. The constants A and B are specific to each oscillator and are estimated by measuring the period of fluids of known density.

B.2. Reagents and products

B.2.1. Reference fluids

Two reference fluids are used to adjust the densimeter. The densities of the reference fluids should encompass the densities of the wines or musts to be analysed. A spread of greater than 0.01000 g/cm³ between the densities of the reference fluids is recommended.

The reference fluids used to measure the density of the wines or musts by electronic densimetry are as follows:

dry air (unpolluted),
Type II water for analytical usage (ISO standard 3696), or of equivalent analytical purity,
hydro-alcoholic solutions, wines or musts whose densities have been determined by a different Type I method, for which the uncertainty does not exceed 0.00005 g/cm³ at the temperature of 20.00 0.05 °C,
solutions calibrated with traceability to the International System of Units, with viscosities of less than 2 mm²/s, for which the uncertainty does not exceed 0.00005 g/cm³ at the temperature of 20.00 0.05 °C.

B.2.2. Cleaning and drying products

Use products that ensure the perfectly clean and dried state of the measuring cell, according to the residues and manufacturer’s indications. For example:

detergents, acids, etc.,
organic solvents: 96% vol. ethanol, pure acetone, etc.

B.3. Apparatus and equipment

B.3.1. Electronic densimeter with frequency oscillator

The electronic densimeter consists of the following elements:

a measuring cell consisting of a measuring tube and a temperature controller,
a system for setting up an oscillation tube and measuring the period of oscillation,
a digital display and possibly a calculator,
sample injector syringe, autosampler or other equivalent system.

The densimeter is placed on a perfectly stable support isolated from all vibrations.

B.3.2. Temperature control of the measuring cell

Locate the measuring tube in a temperature-controlled system. Temperature stability should be better than 0.02 °C.

It is necessary to control the temperature of the measuring cell when the densimeter makes this possible, because this strongly influences the determination results. The density of a hydro-alcoholic solution with an alcoholic strength by volume (ABV) of 10% vol. is 0.98471 g/cm³ at 20 °C and 0.98447 g/cm³ at 21 °C, equating to a spread of 0.00024 g/cm³.

The test temperature is 20 °C. Measure the cell temperature with a resolution thermometer accurate to less than 0.01 °C and with traceability to national standards. This should enable a temperature measurement with an uncertainty of better than 0.07 °C.

B.3.3. Calibration of the apparatus

The apparatus should be calibrated before using it for the first time, then periodically or if the verification is not satisfactory. The objective is to use two reference fluids to calculate the constants A and B [see formula (2), B.1]. To carry out the calibration in practice, refer to the user manual of the apparatus. In principle, this calibration is carried out with dry air (taking into account the atmospheric pressure) and very pure water (B.2.1).

B.3.4. Calibration verification

In order to verify the calibration, the density of the reference fluids is measured.

Every day of use, a density check of the air is carried out. A difference between the theoretical density and observed density of more than 0.00008 g/cm³ may indicate that the tube is clogged. In that case, it should be cleaned. After cleaning, verify the air density again. If the verification is not conclusive, adjust the apparatus.

Check the density of the water; if the difference between the theoretical density and the density observed is greater than 0.00008 g/cm³, adjust the apparatus.

If verification of the cell temperature is difficult, it is possible to directly check the density of a hydro-alcoholic solution of comparable density to those of the samples analysed.

B.3.5. Checks

When the difference between the theoretical density of the reference solution (known with an uncertainty of 0.00005 g/cm³) and the measured density is above 0.00008 g/cm³, the calibration of the apparatus should be checked.

B.4. Procedure

Before measuring, if necessary, clean and dry the cell with acetone or absolute alcohol and dry air. Rinse the cell with the sample.

Inject the sample into the cell (using a syringe, autosampler or other equivalent system) so that it is filled completely. While filling, check that all air bubbles have been removed. The sample should be homogenous and not contain any solid particles. Where necessary, filter to remove any suspended matter before analysis.

If there is a lighting system available that makes it possible to verify the absence of bubbles, turn it off quickly after checking because the heat generated by the lamp can influence the measuring temperature (for apparatus with a permanent lighting system, this statement is not applicable).

The operator should ensure that the temperature of the measuring cell is stable.

Once the reading has been stabilised, record the density, ρ_20⁰C.

If the apparatus only provides the period, the density can be calculated from the A and B constants (refer to the instructions for the equipment or Annex I of the method OIV-MA-AS312-01A).

B.5. Expression of results

The density is expressed in g/cm³ to 5 decimal places.

B.6. Precision parameters

The precision parameters are detailed in Table 4 of Annex II.

Repeatability:

r = 0.00011 g/cm³

Reproducibility:

R = 0.00025 g/cm³

Method C: Density at 20 °C and specific gravity at 20 °C measured using a hydrostatic balance (Type I Method)

C.1. Principle

The density of wine or musts can be measured by densimetry with a hydrostatic balance following the Archimedes principle, by which any body immersed in a fluid experiences an upwards force equal to the weight of the displaced fluid.

C.2. Reagents and products

C.2.1. Type II water for analytical usage (ISO 3696 standard), or of equivalent purity

C.2.2. Floater-washing solution (sodium hydroxide, 30 % m/v)

To prepare a 100-mL solution weigh 30 g of sodium hydroxide and fill using 96% vol. ethanol.

C.3. Apparatus and materials

Normal laboratory apparatus, particularly:

C.3.1. Single-pan hydrostatic balance accurate to the nearest 1 mg

C.3.2. Floater with at least 20 mL volume, specifically adapted for the balance, suspended by a thread with a diameter of less than or equal to 0.1 mm

C.3.3. Cylindrical test tube with level indicator. The floater should be able to fit entirely within the test tube volume below the level indicator; only the hanging thread should break the surface of the liquid. The cylindrical test tube should have an inside diameter at least 6 mm greater than that of the floater.

C.3.4. Thermometer (or temperature-measurement probe) with degree and 10^th-of-a-degree graduations, from 10°C to 40°C, calibrated to ± 0.06 °C

C.3.5. Masses calibrated by an accredited body.

C.4. Procedure

After each measurement, the floater and the test tube should be cleaned with distilled water, wiped with soft laboratory paper that does not lose its fibres and rinsed with solution whose density is to be determined. These measurements should be carried out once the apparatus has reached a stable level in order to limit alcohol loss through evaporation.

C.4.1. Calibration of the apparatus

C.4.1.1. Balance calibration

While balances usually have internal calibration systems, hydrostatic balances should be calibrated with weights with traceability to the International System of Units.

C.4.1.2. Floater calibration

Fill the cylindrical test tube up to the level indicator with water (C.2.1) whose temperature is between 15 °C and 25 °C, but preferably at 20°C.

Plunge the floater and the thermometer into the liquid, shake, note down the density on the apparatus and, if necessary, adjust the reading in order for it to be equal to that of the water at the measurement temperature.

C.4.1.3. Verification using a solution of known density

Fill the cylindrical test tube up to the level indicator with a solution of known density at a temperature of between 15°C and 25 °C, preferably at 20°C.

Immerse the floater and the thermometer in the liquid, stir, read the density of the liquid indicated by the apparatus and record the density and the temperature where the density is measured at t °C (ρ_t).

If necessary, correct ρusing a ρt density table of hydro-alcoholic mixtures (Table II in Annex I).

The density determined in this way should be identical to the previously determined density.

Note: This solution of known density can also replace water for floater calibration.

C.4.2. Determination of the density

Pour the test sample into the cylindrical test tube up to the level indicator.

Plunge the floater and the thermometer into the liquid, shake and note down the density on the apparatus. Note the temperature if the density is measured at t°C (ρt).

Correct ρt using a ρt density table of hydro-alcoholic mixtures (Table II in the Annex).

C.4.3. Cleaning of the floater and cylindrical test tube

Plunge the floater into the washing solution in the test tube.

Allow to soak for one hour while turning the floater regularly.

Rinse with tap water, then with distilled water.

Wipe with soft laboratory paper that does not lose its fibres.

Carry out these operations when the floater is used for the first time and then on a regular basis when necessary.

C.5. Expression of results

The density is expressed in g/cm³ to 5 decimal places.

C.6. Precision parameters

The precision parameters are detailed in Table 4 of Annex II.

r = 0.00025 g/cm³
R = 0.00067 g/cm³

Method D: Density measured by hydrometry (Type IV Method)

D.1. Principle

The density and specific gravity at 20 °C are determined for the test sample by hydrometry following the Archimedes principle. A weighted cylinder equipped with a graduated stem is more or less immersed into the liquid sample whose density is to be determined. The density of the liquid is read directly on the graduation of the stem at the level of the meniscus.

D.2. Apparatus

D.2.1. Hydrometer

Hydrometers should meet ISO requirements relating to their dimensions and graduations.

They should have a cylindrical body and a circular stem with a cross-section of at least 3 mm in diameter. For dry wines, they should be graduated in g/cm³ from 0.983 to 1.003, with graduation marks at every 0.001 and 0.0002 interval. All of the marks at 0.001 intervals should be separated from the next by at least 5 mm. For the measurement of the specific gravity of dealcoholized wines, liqueur wines and musts, a set of 5 hydrometers are to be used, graduated (in g/cm³) from 1.000-1.030; 1.030-1.060; 1.060-1.090; 1.090-1.120; 1.120-1.150. These hydrometers are to be graduated for density at 20 °C by marks and intervals of no greater than 0.001 and 0.0005, with all the marks at the 0.001 intervals being separated from the next by at least 3 mm.

These hydrometers should be graduated so that they can be read at ‘top of the meniscus’. The indication of the graduation in density at 20 °C or specific gravity at 20 °C, and of the reading at the top of the meniscus, is to be given either on the graduated scale, or on a strip of paper attached to the bulb.

This apparatus should be calibrated with traceability to the International System of Units.

D.2.2. Thermometer graduated to intervals of no greater than 0.5 °C, calibrated with traceability to the International System of Units.

D.2.3. Measuring cylinder with dimensions that allow for the immersion of the thermometer and the hydrometer without contact with the sides, held vertically.

D.3. Measurement method

Place 250mL of the test sample (4) in the measuring cylinder (D.2.3) and insert the hydrometer and thermometer. Stir the sample and wait 1 minute to allow temperature equilibration, then read the thermometer. Remove the thermometer and, after 1 minute of rest, read the apparent density at t°C on the stem of the hydrometer.

Correct the apparent density as read at t°C for the effect of the temperature, using the tables in Annex I applying to dry wines (Table V), natural and concentrated musts (Table VI) and liqueur wines (Table VII).

D.4. Expression of results

The density is expressed in g/cm³ to 4 decimal places

Annexes

Annex I Tables

TABLE I

F factors by which the mass of the water in the Pyrex pycnometer at t °C has to be multiplied to calculate the volume of the pycnometer at 20 °C

t ^oC	F	t ^oC	F	t ^oC	F	t ^oC	F	t ^oC	F	t ^oC	F	t ^oC	F
10.0	1.000398	13.0	1.000691	16.0	1.001097	19.0	1.001608	22.0	1.002215	25.0	1.002916	28.0	1.003704
.1	1.000406	.1	1.000703	.1	1.001113	.1	1.001627	.1	1.002238	.1	1.002941	.1	1.003731
.2	1.000414	.2	1.000714	.2	1.001128	.2	1.001646	.2	1.002260	.2	1.002966	.2	1.003759
.3	1.000422	.3	1.000726	.3	1.001144	.3	1.001665	.3	1.002282	.3	1.002990	.3	1.003797
.4	1.000430	.4	1.000738	.4	1.001159	.4	1.001684	.4	1.002304	.4	1.003015	.4	1.003815
10.5	1.000439	13.5	1.000752	16.5	1.001175	19.5	1.001703	22.5	1.002326	25.5	1.003041	28.5	1.003843
.6	1.000447	.6	1.000764	.6	1.001191	.6	1.001722	.6	1.002349	.6	1.003066	.6	1.003871
.7	1.000456	.7	1.000777	.7	1.001207	.7	1.001741	.7	1.002372	3	1.003092	.7	1.003899
.8	1.000465	.8	1.000789	.8	1.001223	.8	1.001761	.8	1.002394	.8	1.003117	.8	1.003928
.9	1.000474	.9	1.000803	.9	1.001239	9	1.001780	.9	1.002417	.9	1.003143	.9	1.003956
11.0	1.000483	14.0	1.000816	17.0	1.001257	20.0	1.001800	23.0	1.002439	26.0	1.003168	29.0	1.003984
.1	1.000492	.1	1.000829	.1	1.001273	.1	1.001819	.1	1.002462	.1	1.003194	.1	1.004013
.2	1.000501	.2	1.000842	.2	1.001286	.2	1.001839	.2	1.002485	1	1.003222	2	1.004042
3	1.000511	3	1.000855	3	1.001306	.3	1.001959	.3	1.002508	.3	1.003247	.3	1.004071
.4	1.000520	.4	1.000868	.4	1.001323	.4	1.001880	.4	1.002531	.4	1.003273	.4	1.004099
11.5	1.000530	14.5	1.000882	17.5	1.001340	20.5	1.001900	23.5	1.002555	26.5	1.003299	29.5	1.004128
.6	1.000540	.6	1.000895	.6	1.001357	.6	1.001920	.6	1.002578	.6	1.003326	.6	1.004158
.7	1.000550	.7	1.000909	.7	1.001374	.7	1.001941	3	1.002602	.7	1.003352	.7	1.004187
.8	1.000560	.8	1.000923	.8	1.001391	.8	1.001961	.8	1.002625	.8	1.003379	.8	1.004216
.9	1.000570	.9	1.000937	.9	1.001409	.9	1.001982	.9	1.002649	.9	1.003405	.9	1.004245
12.0	1.000580	15.0	1.000951	18.0	1.001427	21.0	1.002002	24.0	1.002672	27.0	1.003432	30.0	1.004275
.1	1.000591	.1	1.000965	.1	1.001445	.1	1.002023	.1	1.002696	.1	1.003459
.2	1.000601	.2	1.000979	.2	1.001462	.2	1.002044	.2	1.002720	.2	1.003485
.3	1.000612	.3	1.000993	.3	1.001480	.3	1.002065	.3	1.002745	.3	1.003513
.4	1.000623	.4	1.001008	.4	1.001498	.4	1.002086	.4	1.002769	.4	1.003540
12.5	1.000634	15.5	1.001022	18.5	1.001516	21.5	1.002107	24.5	1.002793	27.5	1.003567
.6	1.000645	.6	1.001037	.6	1.001534	.6	1.002129	.6	1.002817	.6	1.003594
.7	1.000656	.7	1.001052	.7	1.001552	.7	1.002151	.7	1.002842	.7	1.003621
.8	1.000668	.8	1.001067	.8	1.001570	.8	1.002172	.8	1.002866	.8	1.003649
.9	1.000679	.9	1.001082	.9	1.001589	.9	1.002194	.9	1.002891	.9	1.003676

TABLE II

Temperature corrections, c, required for the density of dry wines and dealcoholised wines,

measured using a Pyrex-glass pycnometer at °C, in order to correct to 20 °C.

	- if t°C is lower than 20°C
	+ if t°C is higher than 20°C

		Alcoholic strength
		0	5	6	7	8	9	10	11	12	13	14	15	16	17	18	19	20	21	22	23	24	25	26	27
Temperature in °C	10	1.59	1.64	1.67	1.71	1.77	1.84	1.91	2.01	2.11	2.22	2.34	2.46	2.60	2.73	2.88	3.03	3.19	3.35	3.52	3.70	3.87	4.06	4.25	4.44
	11	1.48	1.53	1.56	1.60	1.64	1.70	1.77	1.86	1.95	2.05	2.16	2.27	2.38	2.51	2.63	2.77	2.91	3.06	3.21	3.36	3.53	3.69	3.86	4.03
	12	1.36	1.40	1.43	1.46	1.50	1.56	1.62	1.69	1.78	1.86	1.96	2.05	2.16	2.27	2.38	2.50	2.62	2.75	2.88	3.02	3.16	3.31	3.46	3.61
	13	1.22	1.26	1.28	1.32	1.35	1.40	1.45	1.52	1.59	1.67	1.75	1.83	1.92	2.01	2.11	2.22	2.32	2.44	2.55	2.67	2.79	2.92	3.05	3.18
	14	1.08	1.11	1.13	1.16	1.19	1.23	1.27	1.33	1.39	1.46	1.52	1.60	1.67	1.75	1.94	1.93	2.03	2.11	2.21	2.31	2.42	2.52	2.63	2.74.
	15	0.92	0.96	0.97	0.99	1.02	1.05	1.09	1.13	1.19	1.24	1.30	1.36	1.42	1.48	1.55	1.63	1.70	1.78	1.86	1.95	2.03	2.12	2.21	2.30
	16	0.76	0.79	0.80	0.81	0.94	0.86	0.89	0.93	0.97	1.01	1.06	1.10	1.16	1.21	1.26	1.32	1.38	1.44	1.51	1.57	1.64	1.71	1.78	1.85
	17	0.59	0.61	0.62	0.63	0.65	0.67	0.69	0.72	0.75	0.78	0.81	0.85	0.88	0.95	0.96	1.01	1.05	1.11	1.15	1.20	1.25	1.30	1.35	1.40
	18	0.40	0.42	0.42	0.43	0.44	0.46	0.47	0.49	0.51	0.53	0.55	0.57	0.60	0.63	0.65	0.68	0.71	0.74	0.77	0.81	0.84	0.87	0.91	0.94
	19	0.21	0.21	0.22	0.22	0.23	0.23	0.24	0.25	0.26	0.27	0.28	0.29	0.30	0.32	0.33	0.34	0.36	0.37	0.39	0.41	0.42	0.44	0.46	0.47
	20
	21	0.21	0.22	0.22	0.23	0.23	0.24	0.25	0.26	0.27	0.28	0.29	0.30	0.31	0.32	0.34	0.36	0.37	0.38	0.40	0.41	0.43	0.44	0.46	0.48
	22	0.44	0.45	0.46	0.47	0.48	0.49	0.51	0.52	0.54	0.56	0.59	0.61	0.63	0.66	0.69	0.71	0.74	0.77	0.80	0.83	0.87	0.90	0.93	0.97
	23	0.68	0.70	0.71	0.72	0.74	0.76	0.78	0.80	0.83	0.86	0.90	0.93	0.96	1.00	1.03	1.08	1.13	1.17	1.22	1.26	1.31	1.37	1.41	1.46
	24	0.93	0.96	0.97	0.99	1.01	1.03	1.06	1.10	1.13	1.18	1.22	1.26	1.31	1.36	1.41	1.47	1.52	1.58	1.64	1.71	1.77	1.84	1.90	1.97
	25	1.19	1.23	1.25	1.27	1.29	1.32	1.36	1.40	1.45	1.50	1.55	1.61	1.67	1.73	1.80	1.86	1.93	2.00	2.08	2.16	2.24	2.32	2.40	2.48
	26	1.47	1.51	1.53	1.56	1.59	1.62	1.67	1.72	1.77	1.83	1.90	1.96	2.03	2.11	2.19	2.27	2.35	2.44	2.53	2.62	2.72	2.81	2.91	3.01
	27	1.75	1.80	1.82	1.85	1.89	1.93	1.98	2.04	2.11	2.18	2.25	2.33	2.41	2.50	2.59	2.68	2.78	2.88	2.98	3.09	3.20	3.31	3.42	3.33
	28	2.04	2.10	2.13	2.16	2.20	2.25	2.31	2.38	2.45	2.53	2.62	2.70	2.80	2.89	3.00	3.10	3.21	3.32	3.45	3.57	3.69	3.82	3.94	4.07
	29	2.34	2.41	2.44	2.48	2.53	2.58	2.65	2.72	2.81	2.89	2.99	3.09	3.19	3.30	3.42	3.53	3.65	3.78	3.92	4.05	4.19	4.33	4.47	4.61
	30	2.66	2.73	2.77	2.81	2.86	2.92	3.00	3.08	3.17	3.27	3.37	3.48	3.59	3.72	3.84	3.97	4.11	4.25	4.40	4.55	4.70	4.85	4.92	5.17

Note: This table can be used to convert the density to

TABLE III

Temperature corrections, c, required for the density of natural or concentrated musts,

measured using a Pyrex-glass pycnometer at t °C, in order to correct to 20 °C

	- if t°C is lower than 20°C
	+ if t°C is higher than 20°C

		Density
		1.05	1.06	1.07	1.08	1.09	1.10	1.11	1.12	1.13	1.14	1.15	1.16	1.18	1.20	1.22	1.24	1.26	1.28	1.30	1.32	1.34	1.36
Temperature in °C	10	2.31	2.48	2.66	2.82	2.99	3.13	3.30	3.44	3.59	3.73	3.88	4.01	4.28	4.52	4.76	4.98	5.18	5.42	5.56	5.73	5.90	6.05
	11	2.12	2.28	2.42	2.57	2.72	2.86	2.99	3.12	3.25	3.37	3.50	3.62	3.85	4.08	4.29	4148	4.67	4.84	5.00	5.16	5.31	5.45
	12	1.92	2.06	2.19	2.32	2.45	2.58	2.70	2.92	2.94	3.04	3.15	3.26	3.47	3.67	3.85	4.03	4.20	4.36	4.51	4.65	478	4.91
	13	1.72	1.84	1.95	2.06	2.17	2.27	2.38	2.48	2.58	2.69	2.78	2.89	3.05	3.22	3.39	3.55	3.65	3.84	3.98	4.11	4.24	4.36
	14	1.52	1.62	1.72	1.81	1.90	2.00	2.09	2.17	2.26	2.34	2.43	2.51	2.66	2.82	2.96	3.09	3.22	3.34	3.45	3.56	3.67	3.76
	15	1.28	1.36	1.44	1.52	1.60	1.67	1.75	1.82	1.89	1.96	2.04	2.11	2.24	2.36	2.48	2.59	2.69	2.79	2.88	2.97	3.03	3.10
	16	1.05	1.12	1.18	1.25	1.31	1.37	1.43	1.49	1.55	1.60	1.66	1.71	1.81	1.90	2.00	2.08	2.16	2.24	2.30	2.37	2.43	2.49
	17	0.80	0.86	0.90	0.95	1.00	1.04	1.09	1.13	1.18	1.22	1.26	1.30	1.37	1.44	1.51	1.57	1.62	1.68	1.72	1.76	1.80	1.84
	18	0.56	0.59	0.62	0.66	0.68	0.72	0.75	0.77	0.80	0.83	0.85	0.88	0.93	0.98	1.02	1.05	1.09	1.12	1.16	1.19	1.21	1.24
	19	0.29	0.31	0.32	0.34	0.36	0.37	0.39	0.40	0.42	0.43	0.44	0.45	0.48	0.50	0.52	0.54	0.56	0.57	0.59	0.60	0.61	0.62
	20
	21	0.29	0.30	0.32	0.34	0.35	0.37	0.38	0.40	0.41	0.42	0.44	0.46	0.48	0.50	0.53	0.56	0.58	0.59	0.60	0.61	0.62	0.62
	22	0.58	0.61	0.64	0.67	0.70	0.73	0.76	0.79	0.81	0.84	0.87	0.90	0.96	1.03	1.05	1.09	1.12	1.15	1.18	1.20	1.22	1.23
	23	0.89	0.94	0.99	1.03	1.08	1.12	1.16	1.20	1.25	1.29	1.33	1.37	1.44	1.51	1.57	1.63	1.67	1.73	1.77	1.80	1.82	1.94
	24	1.20	1.25	1.31	1.37	1.43	1.49	1.54	1.60	1.66	1.71	1.77	1.82	1.92	2.01	2.10	2.17	2.24	2.30	2.36	2.40	2.42	2.44
	25	1.51	1.59	1.66	1.74	1.81	1.88	1.95	2.02	2.09	2.16	2.23	2.30	2.42	2.53	2.63	2.72	2.82	2.89	2.95	2.99	3.01	3.05
	26	1.84	1.92	2.01	2.10	2.18	2.26	2.34	2.42	2.50	2.58	2.65	2.73	2.87	3.00	3.13	3.25	3.36	3.47	3.57	3.65	372	3.79
	27	2.17	2.26	2.36	2.46	2.56	2.66	2.75	2.84	2.93	3.01	3.10	3.18	3.35	3.50	3.66	3.80	3.93	4.06	4.16	4.26	4.35	4.42
	28	2.50	2.62	2.74	2.85	2.96	3.07	3.18	3.28	3.40	3.50	3.60	3.69	3.87	4.04	4.21	4.36	4.50	4.64	4.75	4.86	4.94	5.00
	29	2.86	2.98	3.10	3.22	3.35	3.47	3.59	3.70	3.82	3.93	4.03	4.14	4.34	4.53	4.72	4.89	5.05	5.20	5.34	5.46	5.56	5.64
	30	3.20	3.35	3.49	3.64	3.77	3.91	4.05	4.17	4.30	4.43	4.55	4.67	4.90	5.12	5.39	5.51	5.68	5.94	5.96	6.09	6.16	6.22

Note: This table can be used to convert the density to

Table IV

Temperature corrections, c, required for the density of liqueur wines, measured using a Pyrex-glass pycnometer at t °C, in order to correct to 20 °C

	- if t°C is lower than 20°C
	+ if t°C is higher than 20°C

		13% vol. wines							15% vol. wines							17% vol. wines
		Density							Density							Density
		1.000	1.020	1.040	1.060	1.080	1.100	1.120	1.000	1.020	1.040	1.060	1.080	1.100	1.120	1.000	1.020	1.040	1.060	1.080	1.100	1.120
Temperature in °C	10	2.36	2.71	3.06	3.42	3.72	3.96	4.32	2.64	2.99	3.36	3.68	3.99	4.30	4.59	2.94	3.29	3.64	3.98	4.29	4.60	4.89
	11	2.17	2.49	2.80	2.99	3.39	3.65	3.90	2.42	2.73	3.05	3.34	3.63	3.89	4.15	2.69	3.00	3.32	3.61	3.90	4.16	4.41
	12	1.97	2.25	2.53	2.79	3.05	3.29	3.52	2.19	2.47	2.75	3.01	3.27	3.51	3.73	2.42	2.70	2.98	3.24	3.50	3.74	3.96
	13	1.78	2.02	2.25	2.47	2.69	2.89	3.09	1.97	2.21	2.44	2.66	2.87	3.08	3.29	2.18	2.42	2.64	2.87	3.08	3.29	3.49
	14	1.57	1.78	1.98	2.16	2.35	2.53	2.70	1.74	1.94	2.14	2.32	2.52	2.69	2.86	1.91	2.11	2.31	2.50	2.69	2.86	3.03
	15	1.32	1.49	1.66	1.82	1.97	2.12	2.26	1.46	1.63	1.79	1.95	2.10	2.25	2.39	1.60	1.77	1.93	2.09	2.24	2.39	2.53
	16	1.08	1.22	1.36	1.48	1.61	1.73	1.84	1.18	1.32	1.46	1.59	1.71	1.83	1.94	1.30	1.44	1.58	1.71	1.83	1.95	2.06
	17	0.83	0.94	1.04	1.13	1.22	1.31	1.40	0.91	1.02	1.12	1.21	1.30	1.39	1.48	1.00	1.10	1.20	1.30	1.39	1.48	1.56
	18	0.58	0.64	0.71	0.78	0.84	0.89	0.95	0.63	0.69	0.76	0.83	0.89	0.94	1.00	0.69	0.75	0.82	0.89	0.95	1.00	1.06
	19	0.30	0.34	0.37	0.40	0.43	0.46	0.49	0.33	0.37	0.40	0.43	0.46	0.49	0.52	0.36	0.39	0.42	0.46	0.49	0.52	0.54
	20
	21	0.30	0.33	0.36	0.40	0.43	0.46	0.49	0.33	0.36	0.39	0.43	0.46	0.49	0.51	0.35	0.39	0.42	0.45	0.48	0.51	0.54
	22	0.60	0.67	0.73	0.80	0.85	0.91	0.98	0.65	0.72	0.78	0.84	0.90	0.96	1.01	0.71	0.78	0.84	0.90	0.96	1.01	1.07
	23	0.93	1.02	1.12	1.22	1.30	1.39	1.49	1.01	1.10	1.20	1.29	1.38	1.46	1.55	1.10	1.19	1.29	1.38	1.46	1.55	1.63
	24	1.27	1.39	1.50	1.61	1.74	1.84	1.95	1.37	1.49	1.59	1.72	1.84	1.95	2.06	1.48	1.60	1.71	1.83	1.95	2.06	2.17
	25	1.61	1.75	1.90	2.05	2.19	2.33	2.47	1.73	1.87	2.02	2.17	2.31	2.45	2.59	1.87	2.01	2.16	2.31	2.45	2.59	2.73
	26	1.94	2.12	2.29	2.47	2.63	2.79	2.95	2.09	2.27	2.44	2.62	2.78	2.94	3.10	2.26	2.44	2.61	2.79	2.95	3.11	3.26
	27	2.30	2.51	2.70	2.90	3.09	3.27	3.44	2.48	2.68	2.87	3.07	3.27	3.45	3.62	2.67	2.88	3.07	3.27	3.46	3.64	3.81
	28	2.66	2.90	3.13	3.35	3.57	3.86	4.00	2.86	3.10	3.23	3.55	3.77	3.99	4.20	3.08	3.31	3.55	3.76	3.99	4.21	4.41
	29	3.05	3.31	3.56	3.79	4.04	4.27	4.49	3.28	3.53	3.77	4.02	4.26	4.49	4.71	3.52	3.77	4.01	4.26	4.50	4.73	4.95
	30	3.44	3.70	3.99	4.28	4.54	4.80	5.06	3.68	3.94	4.23	4.52	4.79	5.05	5.30	3.95	4.22	4.51	4.79	5.07	5.32	5.57

TABLE IV (continued)

Temperature corrections, c, required for the density of liqueur wines, measured using a Pyrex-glass pycnometer at t °C, in order to correct to 20 °C

	- if t°C is lower than 20°C
	+ if t°C is higher than 20°C

		19% vol. wines														21% vol. wines
		Density														Density
		1.000		1.020		1.040		1.060		1.000		1.100		1.120		1.000		1.020		1.040		1.060		1.080		1.100	1.120
Temperature in °C	10		3.27		3.62		3.97		4.30		4.62		4.92		5.21		3.62		3.97		4.32		4.66		4.97	5.27	5.56
	11		2.99		3.30		3.61		3.90		4.19		4.45		4.70		3.28		3.61		3.92		4.22		4.50	4.76	5.01
	12		2.68		2.96		3.24		3.50		3.76		4.00		4.21		2.96		3.24		3.52		3.78		4.03	4.27	4.49
	13		2.68		2.96		3.24		3.50		3.76		4.00		4.21		2.96		3.24		3.52		3.78		4.03	4.27	4.49
	14		2.11		2.31		2.51		2.69		2.88		3.05		3.22		2.31		2.51		2.71		2.89		3.08	3.25	3.43
	15		1.76		1.93		2.09		2.25		2.40		2.55		2.69		1.93		2.10		2.26		2.42		2.57	2.72	2.86
	16		1.43		1.57		1.70		1.83		1.95		2.08		2.18		1.56		1.70		1.84		1.97		2.09	2.21	2.32
	17		1.09		1.20		1.30		1.39		1.48		1.57		1.65		1.20		1.31		1.41		1.50		1.59	1.68	1.77
	18		0.76		0.82		0.88		0.95		1.01		1.06		1.12		0.82		0.88		0.95		1.01		1.08	1.13	1.18
	19		0.39		0.42		0.45		0.49		0.52		0.55		0.57		0.42		0.46		0.49		0.52		0.55	0.58	0.61
	20
	21		0.38		0.42		0.45		0.48		0.51		0.54		0.57		0.41		0.45		0.48		0.51		0.54	0.57	0.60
	22		0.78		0.84		0.90		0.96		1.02		1.07		1.13		0.84		0.90		0.96		1.02		1.08	1.14	1.19
	23		1.19		1.28		1.38		1.47		1.55		1.64		1.72		1.29		1.39		1.48		1.57		1.65	1.74	1.82
	24		1.60		1.72		1.83		1.95		2.06		2.18		2.29		1.73		1.85		1.96		2.08		2.19	2.31	2.42
	25		2.02		2.16		2.31		2.46		2.60		2.74		2.88		2.18		2.32		2.47		2.62		2.76	2.90	3.04
	26		2.44		2.62		2.79		2.96		3.12		3.28		3.43		2.53		2.81		2.97		3.15		3.31	3.47	3.62
	27		2.88		3.08		3.27		3.42		3.66		3.84		4.01		3.10		3.30		3.47		3.69		3.88	4.06	4.23
	28		3.31		3.54		3.78		4.00		4.22		4.44		4.64		3.56		3.79		4.03		4.25		4.47	4.69	4.89
	29		3.78		4.03		4.27		4.52		4.76		4.99		5.21		4.06		4.31		4.55		4.80		5.04	5.27	5.48
	30		4.24		4.51		4.80		5.08		5.36		5.61		5.86		4.54		4.82		5.11		5.39		5.66	5.91	6.16

TABLE V

Temperature corrections, c, required for the density of dry wines and dealcoholised dry wines,

measured using an ordinary-glass pycnometer or hydrometer at t °C, in order to correct to 20 °C

	- if t°C is lower than 20°C
	+ if t°C is higher than 20°C

		Alcoholic strength
		0	5		6		7		8		9		10		11		12		13		14		15		16		17		18		19		20		21		22		23		24		25		26		27
Temperature in °C	10	1.45		1.51		1.55		1.58		1.64		1.76		1.78		1.89		1.98		2.09		2.21		2.34		2.47		2.60		2.75		2.93		3.06		3.22		3.39		3.57		3.75		3.93		4.12		4.31
	11	1.35		1.40		1.43		1.47		1.52		1.58		1.65		1.73		1.83		1.93		2.03		2.15		2.26		2.38		2.51		2.65		2.78		2.93		3.08		3.24		3.40		3.57		3.73		3.90
	12	1.24		1.28		1.31		1.34		1.39		1.44		1.50		1.58		1.66		1.75		1.84		1.94		2.04		2.15		2.26		2.38		2.51		2.63		2.77		2.91		3.05		3.19		3.34		3.49
	13	1.12		1.16		1.18		1.21		1.25		1.30		1.35		1.42		1.49		1.56		1.64		1.73		1.82		1.91		2.01		2.11		2.22		2.33		2.45		2.57		2.69		2.81		2.95		3.07
	14	0.99		1.03		1.05		1.07		1.11		1.14		1.19		1.24		1.31		1.37		1.44		1.52		1.59		1.67		1.75		1.84		1.93		2.03		2.13		2.23		2.33		2.44		2.55		2.66
	15	0.86		0.89		0.90		0.92		0.95		0.98		1.02		1.07		1.12		1.17		1.23		1.29		1.35		1.42		1.49		1.56		1.63		1.71		1.80		1.88		1.96		2.05		2.14		2.23
	16	0.71		0.73		0.74		0.76		0.78		0.81		0.84		0.87		0.91		0.95		0.99		1.05		1.10		1.15		1.21		1.27		1.33		1.39		1.45		1.52		1.59		1.66		1.73		1.80
	17	0.55		0.57		0.57		0.59		0.60		0.62		0.65		0.67		0.70		0.74		0.77		0.81		0.84		0.88		0.92		0.96		1.01		1.05		1.10		1.15		1.20		1.26		1.31		1.36
	18	0.38		0.39		0.39		0.40		0.41		0.43		0.44		0.46		0.48		0.50		0.52		0.55		0.57		0.60		0.62		0.65		0.68		0.71		0.74		0.78		0.81		0.85		0.88		0.91
	19	0.19		0.20		0.20		0.21		0.21		0.22		0.23		0.24		0.25		0.26		0.27		0.28		0.29		0.30		0.32		0.33		0.34		0.36		0.38		0.39		0.41		0.43		0.44		0.46
	20
	21	0.21		0.22		0.22		0.23		0.23		0.24		0.25		0.25		0.26		0.27		0.28		0.29		0.31		0.32		0.34		0.35		0.36		0.38		0.39		0.41		0.43		0.44		0.46		0.48
	22	0.43		0.45		0.45		0.46		0.47		0.49		0.50		0.52		0.54		0.56		0.58		0.60		0.62		0.65		0.68		0.71		0.73		0.77		0.80		0.83		0.86		0.89		0.93		0.96
	23	0.67		0.69		0.70		0.71		0.72		0.74		0.77		0.79		0.82		0.85		0.88		0.91		0.95		0.99		1.03		1.07		1.12		1.16		1.21		1.25		1.30		1.35		1.40		1.45
	24	0.91		0.93		0.95		0.97		0.99		1.01		1.04		1.07		1.11		1.15		1.20		1.24		1.29		1.34		1.39		1.45		1.50		1.56		1.62		1.69		1.76		1.82		1.88		1.95
	25	1.16		1.19		1.21		1.23		1.26		1.29		1.33		1.37		1.42		1.47		1.52		1.57		1.63		1.70		1.76		1.83		1.90		1.97		2.05		2.13		2.21		2.29		2.37		2.45
	26	1.42		1.46		1.49		1.51		1.54		1.58		1.62		1.67		1.73		1.79		1.85		1.92		1.99		2.07		2.14		2.22		2.31		2.40		2.49		2.58		2.67		2.77		2.86		2.96
	27	1.69		1.74		1.77		1.80		1.83		1.88		1.93		1.98		2.05		2.12		2.20		2.27		2.35		2.44		2.53		2.63		272		2.82		2.93		3.04		3.14		3.25		3.37		3.48
	28	1.97		2.03		2.06		2.09		2.14		2.19		2.24		2.31		2.38		2.46		2.55		2.63		2.73		2.83		2.93		3.03		3.14		3.26		3.38		3.50		3.62		3.75		3.85		4.00
	29	2.26		2.33		2.37		2.41		2.45		2.50		2.57		2.64		2.73		2.82		2.91		2.99		3.11		3.22		3.34		3.46		3.58		3.70		3.84		3.97		4.11		4.25		4.39		4.54
	30	2.56		2.64		2.67		2.72		2.77		2.83		2.90		2.98		3.08		3.18		3.28		3.38		3.50		3.62		3.75		3.88		4.02		4.16		4.30		4.46		4.61		4.76		4.92		5.07

Note: This table can be used to convert the density to

TABLE VI

Temperature corrections, c, required for the density of concentrated musts, measured using an ordinary-glass pycnometer or hydrometer at t °C, in order to correct to 20 °C.

	- if t°C is lower than 20°C
	+ if t°C is higher than 20°C

		Density
		1.05	1.06	1.07	1.08	1.09	1.10	1.11	1.12	1.13	1.14	1.15	1.16	1.18	1.20	1.22	1.24	1.26	1.28	1.30	1.32	1.34	1.36
Temperature in °C	10	2.17	2.34	2.52	2.68	2.85	2.99	3.16	3.29	3.44	3.58	3.73	3.86	4.13	4.36	4.60	4.82	5.02	5.25	5.39	5.56	-5.73	5.87
	11	2.00	2.16	2.29	2.44	2.59	2.73	2.86	2.99	3.12	3.24	3.37	3.48	3.71	3.94	4.15	4.33	4.52	4.69	4.85	5.01	5.15	5.29
	12	1.81	1.95	2.08	2.21	2.34	2.47	2.58	2.70	2.82	2.92	3.03	3.14	3.35	3.55	3.72	3.90	4.07	4.23	4.37	4.52	4.64	4.77
	13	1.62	1.74	1.85	1.96	2.07	2.17	2.28	2.38	2.48	2.59	2.68	2.77	2.94	3.11	3.28	3.44	3.54	3.72	3.86	3.99	4.12	4.24
	14	1.44	1.54	1.64	1.73	1.82	1.92	2.00	2.08	2.17	2.25	2.34	2.42	2.57	2.73	2.86	2.99	3.12	3.24	3.35	3.46	3.57	3.65
	15	1.21	1.29	1.37	1.45	1.53	1.60	1.68	1.75	1.82	1.89	1.97	2.03	2.16	2.28	2.40	2.51	2.61	2.71	2.80	2.89	2.94	3.01
	16	1.00	1.06	1.12	1.19	1.25	1.31	1.37	1.43	1.49	1.54	1.60	1.65	1.75	1.84	1.94	2.02	2.09	2.17	2.23	2.30	2.36	2.42
	17	0.76	0.82	0.86	0.91	0.96	1.00	1.05	1.09	1.14	1.18	1.22	1.25	1.32	1.39	1.46	1.52	1.57	1.63	1.67	1.71	1.75	1.79
	18	0.53	0.56	0.59	0.63	0.65	0.69	0.72	0.74	0.77	0.80	0.82	0.85	0.90	0.95	0.99	1.02	1.05	1.09	1.13	1.16	1.18	1.20
	19	0.28	0.30	0.31	0.33	0.35	0.36	0.38	0.39	0.41	0.42	0.43	0.43	0.46	0.48	0.50	0.52	0.54	0.55	0.57	0.58	0.59	0.60
	20
	21	0.28	0.29	0.31	0.33	0.34	0.36	0.37	0.39	0.40	0.41	0.43	0.44	0.46	0.48	0.51	0.54	0,56	0.57	0.58	0.59	0.60	0.60
	22	0.55	0.58	0.61	0.64	0.67	0.70	0.73	0.76	0.78	0.81	0.84	0.87	0.93	0.97	1.02	1.06	1.09	1.12	1.15	1.17	1.19	1.19
	23	0.85	0.90	0.95	0.99	1.04	1.08	1.12	1.16	1.21	1.25	1.29	1.32	1.39	1.46	1.52	1.58	1.62	1.68	1.72	1.75	1.77	1.79
	24	1.15	1.19	1.25	1.31	1.37	1.43	1.48	1.54	1.60	1.65	1.71	1.76	1.86	1.95	2.04	2.11	2.17	2.23	2.29	2.33	2.35	2.37
	25	1.44	1.52	1.59	1.67	1.74	1.81	1.88	1.95	2.02	2.09	2.16	2.22	2.34	2.45	2.55	2.64	2.74	2.81	7.87	2.90	2.92	2.96
	26	1.76	1.84	1.93	2.02	2.10	2.18	2.25	2.33	2.41	2.49	2.56	2.64	2.78	2.91	3.03	3.15	3.26	3.37	3.47	3.55	3.62	3.60
	27	2.07	2.16	2.26	2.36	2.46	2.56	2.65	2.74	2.83	2.91	3.00	3.07	3.24	3.39	3.55	3.69	3.82	3.94	4.04	4.14	4.23	4.30
	28	2.39	2.51	2.63	2.74	2.85	2.96	3.06	3.16	3.28	3.38	3.48	3.57	3.75	3.92	4.08	4.23	4.37	4.51	4.62	4.73	4.80	4.86
	29	2.74	2.86	2.97	3.09	3.22	3.34	3.46	3.57	3.69	3.90	3.90	4.00	4.20	4.39	4.58	4.74	4.90	5.05	5.19	5.31	5.40	5.48
	30	3.06	3.21	3.35	3.50	3.63	3.77	3.91	4.02	4.15	4.28	4.40	4.52	4.75	4.96	5.16	5.35	5.52	5.67	5.79	5.91	5.99	6.04

Note: This table can be used to convert the density to

TABLE VII

Temperature corrections, c, required for the density of liqueur wines, measured using an ordinary-glass pycnometer or hydromete at t °C, in order to correct to 20 °C

	- if t°C is lower than 20°C
	+ if t°C is higher than 20°C

		13% vol. wines							15% vol. wines							17% vol. wines
		Density							Density							Density
		1.000	1.020	1.040	1.060	1.080	1.100	1.120	1.000	1.020	1.040	1.060	1.080	1.100	1.120	1.000	1.020	1.040	1.060	1.080	1.100	1.120
Temperature in °C	10	2.24	2.58	2.93	3.27	3.59	3.89	4.18	2.51	2.85	3.20	3.54	3.85	4.02	4.46	2.81	3.15	3.50	3.84	4.15	4.45	4.74
	11	2.06	2.37	2.69	2.97	3.26	3.53	3.78	2.31	2.61	2.93	3.21	3.51	3.64	4.02	2.57	2.89	3.20	3.49	3.77	4.03	4.28
	12	1.87	2.14	2.42	2.67	2.94	3.17	3.40	2.09	2.36	2.64	2.90	3.16	3.27	3.61	2.32	2.60	2.87	3.13	3.39	3.63	3.84
	13	1.69	1.93	2.14	2.37	2.59	2.80	3.00	1.88	2.12	2.34	2.56	2.78	2.88	3.19	2.09	2.33	2.55	2.77	2.98	3.19	3.39
	14	1.49	1.70	1.90	2.09	2.27	2.44	2.61	1.67	1.86	2.06	2.25	2.45	2.51	2.77	1.83	2.03	2.23	2.42	2.61	2.77	2.94
	15	1.25	1.42	1.59	1.75	1.90	2.05	2.19	1.39	1.56	1.72	1.88	2.03	2.11	2.32	1.54	1.71	1.87	2.03	2.18	2.32	2.47
	16	1.03	1.17	1.30	1.43	1.55	1.67	1.78	1.06	1.27	1.40	1.53	1.65	1.77	1.88	1.25	1.39	1.52	1.65	1.77	1.89	2.00
	17	0,80	0.90	1.00	1.09	1.17	1.27	1.36	0.87	0.98	1.08	1.17	1.26	1.35	1.44	0.96	1.06	1.16	1.26	1.35	1.44	1.52
	18	0.54	0.61	0.68	0.75	0,81	0.86	0.92	0.60	0.66	0.73	0.80	0.85	0.91	0.97	0.66	0.72	0.79	0.86	0.92	0,97	1.03
	19	0.29	0.33	0.36	0.39	0.42	0.45	0.48	0.32	0.36	0.39	0.42	0.45	0.48	0.51	0.35	0.38	0.41	0.45	0.48	0.51	0.53
	20
	21	0.29	0.32	0.35	0.39	0.42	0.45	0,47	0.32	0.35	0.38	0.42	0.45	0.48	0.50	0.34	0.38	0.41	0.44	0.47	0,50	0.53
	22	0.57	0.64	0.70	0.76	0.82	0.88	0.93	0.63	0.69	0.75	0.81	0.87	0.93	0.99	0.68	0,75	0.81	0.87	0.93	0.99	1.04
	23	0.89	0,98	1.08	1.17	1.26	1.34	1.43	0,97	1.06	1.16	1.25	1.34	1.42	1.51	1.06	1.15	1.25	1.34	1.42	1.51	1.59
	24	1.22	1.34	1.44	1.56	1.68	1.79	1.90	1.32	1.44	1.54	1.66	1.78	1.89	2.00	1.43	1.56	1.65	1.77	1.89	2.00	2.11
	25	1.61	1.68	1.83	1.98	2.12	2.26	2.40	1.66	1.81	1.96	2.11	2.25	2.39	2.52	1.80	1.94	2.09	2.24	2.39	2.52	2.66
	26	1.87	2.05	2.22	2.40	2.56	2.71	2.87	2.02	2.20	2.37	2.54	2.70	2.85	3.01	2.18	2.36	2.53	2.71	2.86	3.02	3.17
	27	2.21	2.42	2.60	2.80	3.00	3.18	3.35	2.39	2.59	2.78	2.98	3.17	3.35	3.52	2.58	2.78	2.97	3.17	3.36	3.54	3.71
	28	2.56	2.80	3.02	3.25	3.47	3.67	3.89	2.75	2.89	3.22	3.44	3.66	3.96	4.07	2.97	3.21	3.44	3.66	3.88	4.09	4.30
	29	2.93	3.19	3.43	3.66	3.91	4.14	4.37	3.16	3.41	3.65	3.89	4.13	4.36	4.59	3.40	3.66	3.89	4.13	4.38	4.61	4.82
	30	3.31	3.57	3.86	4.15	4.41	4.66	4.92	3.55	3.81	4.10	4.38	4.66	4.90	5.16	3.82	4.08	4.37	4.65	4.93	5.17	5.42

TABLE VII (continued)

Temperature corrections, c, required for the density of liqueur wines, measured using an ordinary-glass pycnometer or hydrometer at °C, in order to correct to 20 °C.

	- if t°C is lower than 20°C
	+ if t°C is higher than 20°C

		19% vol. wines							21% vol. wines
		Density							Density
		1.000	1.020	1.040	1.060	1.080	1.100	1.120	1.000	1.020	1.040	1.060	1.080	1.100	1.120
Temperature in °C	10	3.14	3.48	3.83	4.17	4.48	4.78	5.07	3.50	3.84	4.19	4.52	4.83	5.12	5.41
	11	2.87	3.18	3.49	3.78	4.06	4.32	4.57	3.18	3.49	3.80	4.09	4.34	4.63	4.88
	12	2.58	2.96	3.13	3.39	3.65	3.88	4.10	2.86	3.13	3.41	3.67	3.92	4.15	4.37
	13	2.31	2.55	2.77	2.99	3.20	3.41	3.61	2.56	2.79	3.01	3.23	3.44	3.65	3.85
	14	2.03	2.23	2.43	2.61	2.80	2.96	3.13	2.23	2.43	2.63	2.81	3.00	3.16	3.33
	15	1.69	1.86	2.02	2.18	2.33	2.48	2.62	1.86	2.03	2.19	2.35	2.50	2.65	2.80
	16	1.38	1.52	1.65	1.78	1.90	2.02	2.13	1.51	1.65	1.78	1.91	2.03	2.15	2.26
	17	1.06	1.16	1.26	1 .35	1.44	1.53	1.62	1.15	1.25	1.35	1.45	1.54	1.63	1.71
	18	0,73	0.79	0.85	0.92	0.98	1.03	1.09	0.79	0.85	0.92	0.98	1.05	1.10	1.15
	19	0.38	0.41	0.44	0.48	0.51	0.52	0.56	0.41	0.44	0.47	0.51	0.54	0.57	0.59
	20
	21	0.37	0.41	0.44	0.47	0.50	0.53	0.56	0.41	0.44	0.47	0.51	0.54	0.57	0.59
	22	0.75	0.81	0.87	0.93	0.99	1.04	1.10	0.81	0.88	0.94	1.00	1.06	1.10	1.17
	23	1.15	1.30	1.34	1.43	1.51	1.60	1.68	1.25	1.34	1.44	1.63	1.61	1.70	1.78
	24	1.55	1.67	1.77	1.89	2.00	2.11	2.23	1.68	1.80	1.90	2.02	2.13	2.25	2.36
	25	1.95	2.09	2.24	2.39	2.53	2.67	2.71	2.11	2.25	2.40	2.55	2.69	2.83	2.97
	26	2.36	2.54	2.71	2.89	3.04	3.20	3.35	2.55	2.73	2.90	3.07	3.22	3.38	3.54
	27	2.79	2.99	3.18	3.38	3.57	3.75	3.92	3.01	3.20	3.40	3.59	3.78	3.96	4.13
	28	3.20	3.44	3.66	3.89	4.11	4.32	4.53	3.46	3.69	3.93	4.15	4.36	4.58	4.77
	29	3.66	3.92	4.15	4.40	4.64	4.87	5.08	3.95	4.20	4.43	4.68	4.92	5.15	5.36
	30	4.11	4.37	4.66	4.94	5.22	5.46	5.71	4.42	4.68	4.97	5.25	5.53	5.77	6.02

Annex II

Comparison of results for the methods of measurement of density using a frequency oscillator (Method B) and using a hydrostatic balance (Method C)

Using samples with densities between 0.992 and 1.012 g/cm³, the repeatability and reproducibility were measured using an inter-laboratory test. The densities of the different samples as measured using a hydrostatic balance and using electronic densimetry were compared, including the repeatability and reproducibility values derived from the multi-year inter-comparison tests performed on a large scale.

Samples

Wines with different densities and alcoholic strengths prepared monthly on an industrial scale, taken from a stock of bottles stored under normal conditions, and supplied anonymously to the laboratories.

Laboratories

Laboratories participating in the monthly tests organised by Unione Italiana Vini (Verona, Italy) according to ISO 5725 (UNI 9225) regulations and the International Harmonized Protocol for the Proficiency Testing of Analytical Chemical Laboratories produced by the AOAC, ISO and IUPAC, and ISO 43 and ILAC G13 guidelines. An annual report is provided by the above-mentioned organisation to all participants.

Apparatus
1. An electronic hydrostatic balance (with precision to 5 decimal places), equipped if possible with a data-processing device.
2. An electronic densimeter, equipped if possible with an autosampler.

Analyses

According to the rules for the validation of methods of analysis, each sample was analysed twice consecutively to determine the alcoholic strength.

Results

Table 1 shows the results of the measurements obtained by the laboratories using a hydrostatic balance.

Table 2 shows the results obtained by the laboratories using an electronic densimeter.

Evaluation of results
1. The test results were examined for evidence of individual systemic error (p<0.025) using Cochran’s and Grubbs’ tests successively, according to the procedures described in the internationally accepted Protocol for the Design, Conduct and Interpretation of Method-Performance Studies.

6.2. Repeatability (r) et reproducibility (R)

Calculations for repeatability (r) and reproducibility (R) as defined by the protocol were carried out on the results remaining after the removal of outliers. When assessing a new method, there is often no validated reference or statutory method to compare precision criteria; ‘predicted’ levels of precision and therefore used to compare the precision data obtained from collaborative tests. These predicted levels are calculated from the Horwitz formula. Comparison of the test results and the predicted levels give an indication as to whether the method is sufficiently precise for the level of analyte being measured. The Horwitz predicted value is calculated from the Horwitz equation.

where C is the measured concentration of analyte expressed as a decimal (e.g. 1 g/100 g = 0.01).

The Horrat value gives a comparison of the actual precision measured with the precision predicted by the Horwitz formula for the method and at the particular level of concentration of the analyte. It is calculated as follows:

HoR = RSD_R(measured)/RSD_R(Horwitz)

6.3 Inter-laboratory reproducibility

A Horrat value of 1 usually indicates satisfactory reproducibility, whereas a value of more than 2 usually indicates unsatisfactory reproducibility, i.e. reproducibility that is too variable for analytical purposes or where the variation obtained is greater than that predicted for the type of method employed. Hor is also calculated and used to measure intra-laboratory reproducibility, using the following approximation:

RSD_r(Horwitz) = 0.66 RSD_R(Horwitz) (this assumes the approximation that r = 0.66 R)

CrD95 is the critical difference for a 95% probability level. It is calculated according to Resolution OIV-MA-AS1-08.

Table 3 shows the differences between the measurements obtained by laboratories using an electronic densimeter and those using a hydrostatic balance.

6.4 Precision parameters

Table 4 shows the overall averages for the precision parameters calculated from all monthly tests carried out between January 2008 and December 2010

Table 1: Results obtained by laboratories that conducted tests using a hydrostatic balance (HB)

Sample	Average	Total no. of values	No. of selected values	Repeatability	s_r	RSD_r	Hor	Reproducibility	s_R	RSDRcalc	HoR	No. of repet.	CrD95
01/08	0.995491	130	120	0.0001701	0.0000607	0.0061016	0.0046193	0.0005979	0.0002135	0.0214502	0.0107178	2	0.0004141
02/08	1.011475	146	125	0.0004714	0.0001684	0.0166457	0.0126320	0.0008705	0.0003109	0.0307366	0.0153947	2	0.0005686
03/08	0.992473	174	161	0.0001470	0.0000525	0.0052898	0.0040029	0.0004311	0.0001540	0.0155140	0.0077482	2	0.0002959
04/08	0.993147	172	155	0.0002761	0.0000986	0.0099274	0.0075130	0.0005446	0.0001945	0.0195839	0.0097818	2	0.0003595
05/08	1.004836	150	138	0.0001882	0.0000672	0.0066905	0.0050723	0.0007495	0.0002677	0.0266373	0.0133283	2	0.0005215
06/08	0.993992	152	136	0.0001486	0.0000531	0.0053391	0.0040411	0.0005302	0.0001894	0.0190506	0.0095167	2	0.0003675
07/08	0.992447	162	150	0.0002660	0.0000950	0.0095709	0.0072424	0.0006046	0.0002159	0.0217575	0.0108664	2	0.0004063
08/08	0.992210	162	151	0.0002619	0.0000935	0.0094281	0.0071341	0.0006309	0.0002253	0.0227108	0.0113420	2	0.0004265
09/08	1.002600	148	131	0.0001093	0.0000390	0.0038920	0.0029496	0.0007000	0.0002500	0.0249341	0.0124719	2	0.0004919
10/08	0.994482	174	152	0.0001228	0.0000439	0.0044105	0.0033385	0.0004250	0.0001518	0.0152645	0.0076259	2	0.0002942
11/08	0.992010	136	125	0.0000909	0.0000325	0.0032742	0.0024775	0.0004256	0.0001520	0.0153217	0.0076516	2	0.0002975
01/09	0.994184	174	152	0.0001655	0.0000591	0.0059435	0.0044987	0.0005439	0.0001942	0.0195384	0.0097606	2	0.0003756
02/09	0.992266	118	101	0.0001742	0.0000622	0.0062682	0.0047431	0.0005210	0.0001861	0.0187534	0.0093658	2	0.0003580
03/09	0.991886	164	135	0.0001850	0.0000661	0.0066603	0.0050395	0.0004781	0.0001707	0.0172136	0.0085963	2	0.0003251
04/09	0.993632	180	150	0.0001523	0.0000544	0.0054754	0.0041440	0.0004270	0.0001525	0.0153476	0.0076664	2	0.0002922
05/09	1.011061	116	100	0.0003659	0.0001307	0.0129234	0.0098067	0.0008338	0.0002978	0.0294527	0.0147508	2	0.0005605
06/09	0.992063	114	105	0.0002923	0.0001044	0.0105238	0.0079631	0.0005257	0.0001877	0.0189240	0.0094507	2	0.0003418
07/09	0.992708	172	155	0.0002892	0.0001033	0.0104040	0.0078732	0.0006156	0.0002199	0.0221478	0.0110617	2	0.0004106
08/09	0.993064	136	127	0.0002926	0.0001045	0.0105224	0.0079632	0.0007520	0.0002686	0.0270446	0.0135081	2	0.0005112
09/09	1.005285	118	110	0.0002946	0.0001052	0.0104661	0.0079352	0.0007226	0.0002581	0.0256704	0.0128454	2	0.0004892
10/09	0.992905	150	132	0.0002234	0.0000798	0.0080358	0.0060812	0.0004498	0.0001607	0.0161803	0.0080815	2	0.0002978
11/09	0.994016	142	127	0.0001896	0.0000677	0.0068114	0.0051555	0.0004739	0.0001693	0.0170278	0.0085062	2	0.0003214
01/10	0.994734	170	152	0.0002125	0.0000759	0.0076288	0.0057748	0.0005406	0.0001931	0.0194104	0.0096975	2	0.0003672
02/10	0.993177	120	110	0.0002210	0.0000789	0.0079467	0.0060140	0.0005800	0.0002071	0.0208565	0.0104175	2	0.0003950
03/10	0.992799	148	136	0.0002277	0.0000813	0.0081923	0.0061995	0.0015157	0.0005413	0.0545262	0.0272335	2	0.0010657
04/10	0.995420	172	157	0.0002644	0.0000944	0.0094866	0.0071819	0.0006286	0.0002245	0.0225542	0.0112693	2	0.0004244
05/10	1.002963	120	108	0.0007086	0.0002531	0.0252330	0.0191244	0.0013667	0.0004881	0.0486677	0.0243447	2	0.0008991
06/10	0.992546	120	113	0.0001737	0.0000620	0.0062506	0.0047300	0.0005435	0.0001941	0.0195567	0.0097673	2	0.0003744
07/10	0.992831	174	152	0.0003003	0.0001073	0.0108031	0.0081753	0.0006976	0.0002492	0.0250959	0.0125344	2	0.0004699
08/10	0.993184	144	130	0.0001799	0.0000642	0.0064674	0.0048945	0.0005951	0.0002125	0.0213984	0.0106882	2	0.0004111
09/10	1.012293	114	103	0.0002265	0.0000809	0.0079907	0.0060647	0.0014586	0.0005209	0.0514596	0.0257772	2	0.0010251
10/10	0.992289	154	136	0.0006386	0.0002281	0.0229860	0.0173933	0.0007033	0.0002512	0.0253124	0.0126415	2	0.0003812
11/10	0.994649	130	112	0.0002902	0.0001036	0.0104200	0.0078876	0.0005287	0.0001888	0.0189830	0.0094838	2	0.0003445

Table 2: Results obtained by laboratories that conducted tests using an electronic densimeter (ED)

Sample	Average	Total no. of values	No. of selected values	Repeatability	s_r	RSD_r	Hor	Reproducibility	s_R	RSDRcalc	HoR	No. of repet.	CrD95
01/08	0.995504	114	108	0.0000755	0.0000270	0.0027085	0.0020505	0.0001571	0.0000561	0.0056361	0.0028162	2	0.0001045
02/08	1.011493	132	125	0.0001921	0.0000686	0.0067837	0.0051480	0.0004435	0.0001584	0.0156582	0.0078426	2	0.0002985
03/08	0.992491	138	118	0.0000746	0.0000266	0.0026830	0.0020303	0.0002745	0.0000980	0.0098776	0.0049332	2	0.0001905
04/08	0.993129	132	120	0.0001230	0.0000439	0.0044247	0.0033486	0.0002863	0.0001023	0.0102965	0.0051429	2	0.0001929
05/08	1.004892	136	116	0.0000926	0.0000331	0.0032893	0.0024937	0.0004777	0.0001706	0.0169785	0.0084955	2	0.0003346
06/08	0.994063	142	123	0.0000558	0.0000199	0.0020051	0.0015177	0.0001776	0.0000634	0.0063791	0.0031867	2	0.0001224
07/08	0.992498	136	125	0.0000822	0.0000294	0.0029576	0.0022381	0.0002094	0.0000748	0.0075368	0.0037641	2	0.0001423
08/08	0.992270	130	115	0.0000515	0.0000184	0.0018537	0.0014027	0.0001665	0.0000595	0.0059940	0.0029935	2	0.0001149
09/08	1.002603	136	121	0.0000821	0.0000293	0.0029236	0.0022157	0.0003328	0.0001189	0.0118565	0.0059306	2	0.0002318
10/08	0.994493	128	117	0.0000667	0.0000238	0.0023954	0.0018132	0.0001429	0.0000510	0.0051309	0.0025633	2	0.0000954
11/08	0.992017	118	104	0.0000842	0.0000301	0.0030309	0.0022933	0.0001962	0.0000701	0.0070644	0.0035279	2	0.0001322
01/09	0.994216	148	131	0.0000830	0.0000297	0.0029832	0.0022580	0.0001551	0.0000554	0.0055712	0.0027832	2	0.0001015
02/09	0.992251	104	88	0.0000947	0.0000338	0.0034097	0.0025801	0.0002846	0.0001017	0.0102451	0.0051165	2	0.0001956
03/09	0.991875	126	108	0.0001271	0.0000454	0.0045777	0.0034637	0.0002067	0.0000738	0.0074421	0.0037165	2	0.0001316
04/09	0.993654	134	114	0.0001166	0.0000416	0.0041899	0.0031711	0.0002043	0.0000730	0.0073417	0.0036673	2	0.0001322
05/09	1.011035	128	104	0.0002388	0.0000853	0.0084361	0.0064016	0.0003554	0.0001269	0.0125542	0.0062875	2	0.0002211
06/09	0.992104	116	106	0.0001005	0.0000359	0.0036178	0.0027375	0.0003169	0.0001132	0.0114088	0.0056976	2	0.0002184
07/09	0.992720	144	140	0.0001579	0.0000564	0.0056815	0.0042995	0.0002916	0.0001042	0.0104923	0.0052404	2	0.0001905
08/09	0.993139	110	102	0.0001175	0.0000420	0.0042242	0.0031969	0.0003603	0.0001287	0.0129577	0.0064721	2	0.0002479
09/09	1.005276	112	108	0.0001100	0.0000393	0.0039070	0.0029622	0.0003522	0.0001258	0.0125134	0.0062617	2	0.0002429
10/09	0.992912	122	111	0.0000705	0.0000252	0.0025365	0.0019195	0.0002122	0.0000758	0.0076315	0.0038117	2	0.0001458
11/09	0.994031	128	118	0.0000718	0.0000256	0.0025784	0.0019516	0.0001639	0.0000585	0.0058883	0.0029415	2	0.0001102
01/10	0.994752	144	136	0.0000773	0.0000276	0.0027765	0.0021017	0.0001787	0.0000638	0.0064144	0.0032046	2	0.0001203
02/10	0.993181	108	98	0.0001471	0.0000525	0.0052893	0.0040029	0.0001693	0.0000605	0.0060884	0.0030410	2	0.0000945
03/10	0.992665	140	127	0.0001714	0.0000612	0.0061683	0.0046678	0.0002378	0.0000849	0.0085559	0.0042732	2	0.0001447
04/10	0.995502	142	128	0.0001175	0.0000419	0.0042138	0.0031901	0.0002320	0.0000829	0.0083248	0.0041596	2	0.0001532
05/10	1.002851	130	119	0.0001195	0.0000427	0.0042555	0.0032253	0.0002971	0.0001061	0.0105815	0.0052930	2	0.0002014
06/10	0.992607	106	99	0.0001228	0.0000438	0.0044172	0.0033427	0.0002226	0.0000795	0.0080092	0.0040001	2	0.0001449
07/10	0.992871	160	150	0.0001438	0.0000513	0.0051712	0.0039134	0.0003732	0.0001333	0.0134258	0.0067057	2	0.0002539
08/10	0.993235	104	93	0.0000895	0.0000320	0.0032182	0.0024356	0.0002458	0.0000878	0.0088399	0.0044154	2	0.0001680
09/10	1.012328	112	105	0.0000870	0.0000311	0.0030692	0.0023295	0.0003395	0.0001213	0.0119781	0.0060001	2	0.0002361
10/10	0.992308	128	115	0.0000606	0.0000216	0.0021811	0.0016504	0.0001635	0.0000584	0.0058845	0.0029388	2	0.0001116
11/10	0.994683	120	108	0.0001127	0.0000402	0.0040450	0.0030620	0.0001597	0.0000570	0.0057339	0.0028647	2	0.0000979

Table 3: Comparison of results from the hydrostatic balance (BH) and from the electronic densimeter (ED)

Density – Hydrostatic balance				Density – Frequency oscillator				Comparison
Sample	Average value	Total values	Selected values	Sample	Average value	Total values	Selected values	(BH-DE)
01/08	0.995491	130	120	01/08	0.995504	114	108	-0.000013
02/08	1.011475	146	125	02/08	1.011493	132	125	-0.000018
03/08	0.992473	174	161	03/08	0.992491	138	118	-0.000018
04/08	0.993147	172	155	04/08	0.993129	132	120	0.000018
05/08	1.004836	150	138	05/08	1.004892	136	116	-0.000056
06/08	0.993992	152	136	06/08	0.994063	142	123	-0.000071
07/08	0.992447	162	150	07/08	0.992498	136	125	-0.000051
08/08	0.992210	162	151	08/08	0.992270	130	115	-0.000060
09/08	1.002600	148	131	09/08	1.002603	136	121	-0.000003
10/08	0.994482	174	152	10/08	0.994493	128	117	-0.000011
11/08	0.992010	136	125	11/08	0.992017	118	104	-0.000007
01/09	0.994184	174	152	01/09	0.994216	148	131	-0.000031
02/09	0.992266	118	101	02/09	0.992251	104	88	0.000015
03/09	0.991886	164	135	03/09	0.991875	126	108	0.000011
04/09	0.993632	180	150	04/09	0.993654	134	114	-0.000022
05/09	1.011061	116	100	05/09	1.011035	128	104	0.000026
06/09	0.992063	114	105	06/09	0.992104	116	106	-0.000041
07/09	0.992708	172	155	07/09	0.992720	144	140	-0.000012
08/09	0.993064	136	127	08/09	0.993139	110	102	-0.000075
09/09	1.005285	118	110	09/09	1.005276	112	108	0.000009
10/09	0.992905	150	132	10/09	0.992912	122	111	-0.000008
11/09	0.994016	142	127	11/09	0.994031	128	118	-0.000015
01/10	0.994734	170	152	01/10	0.994752	144	136	-0.000018
02/10	0.993177	120	110	02/10	0.993181	108	98	-0.000005
03/10	0.992799	148	136	03/10	0.992665	140	127	0.000134
04/10	0.995420	172	157	04/10	0.995502	142	128	-0.000082
05/10	1.002963	120	108	05/10	1.002851	130	119	0.000112
06/10	0.992546	120	113	06/10	0.992607	106	99	-0.000061
07/10	0.992831	174	152	07/10	0.992871	160	150	-0.000040
08/10	0.993184	144	130	08/10	0.993235	104	93	-0.000052
09/10	1.012293	114	103	09/10	1.012328	112	105	-0.000035
10/10	0.992289	154	136	10/10	0.992308	128	115	-0.000019
11/10	0.994649	130	112	11/10	0.994683	120	108	-0.000035
						average	(BH-DE)	-0.0000162
						standard deviation	(BH-DE)	0.0000447

Table 4: Precision parameters

	Hydrostatic balance (BH)	Electronic densimeter (ED)
No. of selected values	4347	3800
min	0.99189 g/cm³	0.99187 g/cm³
max	1.01229 g/cm³	1.01233 g/cm³
R	0.00067 g/cm³	0.00025 g/cm³
s_R	0.00024 g/cm³	0.000091 g/cm³
R%	0.067%	0.025%
r	0.00025 g/cm³	0.00011 g/cm³
s_r	0.000090 g/cm³	0.000038 g/cm³
r%	0.025%	0.011%

Key:

n: number of selected values

min: lower limit of the measurement range

max: upper limit of the measurement range

r: repeatability

s_r: repeatability standard deviation

r%: relative repeatability (r x 100 / average value)

R: reproducibility

s_R: reproducibility standard deviation

R%: relative reproducibility (R x 100 / average value)

Bibliography

JAULMES, P., OIV Bulletin, 26, No. 274, 1953, p. 6.
JAULMES, P. and BRUN, S., Trav. Soc. Pharm., Montpellier, 16, 1956, p.115;

20, 1960, p. 137; Ann. Fals. Exp. Chim., 46, 1963, pp. 129 and 143.

BRUN, S. and TEP, Y., Ann. Fals. Exp. Chim., 37‑40; OIV, FV, No. 539, 1975.

Evaluation by refractometry of the sugar concentration in grape musts, concentrated grape musts and rectified concentrated grape musts (Type-I)

OIV-MA-AS2-02 Évaluation by refractometry of the sugar concentration in grape musts, concentrated grape musts and rectified concentrated grape musts

Type I method

Principle

The refractive index at 20°C, expressed either as an absolute value or as a percentage by mass of sucrose, is given in the appropriate table to provide a means of obtaining the sugar concentration in grams per liter and in grams per kilogram for grape musts, concentrated grape musts and rectified concentrated grape musts.

Apparatus

Abbe refractometer

The refractometer used must be fitted with a scale giving:

either percentage by mass of sucrose to 0.1%;
or refractive indices to four decimal places.

The refractometer must be equipped with a thermometer having a scale extending at least from +15°C to +25°C and with a system for circulating water that will enable measurements to be made at a temperature of 20 ± 5°C. The operating instructions for this instrument must be strictly adhered to, particularly with regard to calibration and the light source.

Preparation of the sample
1. Must and concentrated must

Pass the must, if necessary, through a dry gauze folded into four and, after discarding the first drops of the filtrate, carry out the determination on the filtered product.

3.2. Rectified concentrated must

Depending on the concentration, use either the rectified concentrated must itself or a solution obtained by making up 200 g of rectified concentrated must to 500 g with water, all weighings being carried out accurately.

Procedure

Bring the sample to a temperature close to 20°C.

Place a small test sample on the lower prism of the refractometer, taking care (because the prisms are pressed firmly against each other) that this test sample covers the glass surface uniformly. Carry out the measurement in accordance with the operating instructions of the instrument used.

Read the percentage by mass of sucrose to within 0.1 or read the refractive index to four decimal places.

Carry out at least two determinations on the same prepared sample. Note the temperature t°C.

Calculation

5.1. Temperature correction

Instruments graduated in percentage by mass of sucrose: use Table I to obtain the temperature correction.
Instruments graduated in refractive index: find the index measured at t°C in Table II to obtain (column 1) the corresponding value of the percentage by mass of sucrose at t°C. This value is corrected for temperature and expressed as a concentration at 20°C by means of Table I.
1. Sugar concentration in must and concentrated must

Find the percentage by mass of sucrose at 20°C in Table II and read from the same row the sugar concentration in grams per liter and grams per kilogram. The sugar concentration is expressed in terms of invert sugar to one decimal place.

5.3. Sugar concentration in rectified concentrated must

Find the percentage by mass of sucrose at 20°C in Table III and read from the same row the sugar concentration in grams per liter and grams per kilogram. The sugar concentration is expressed in terms of invert sugar to one decimal place. If the measurement was made on diluted rectified concentrated must, multiply the result by the dilution factor.

5.4. Refractive index of must, concentrated must and rectified concentrated must

Find the percentage by mass of sucrose at 20°C in Table II and read from the same row the refractive index at 20°C. This index is expressed to four decimal places.

Table I Correction to be made in the case where the percentage by mass of saccharose was determined at a temperature different by 20°C.

Temperature

Percentage by mass measured in %

°C

–0,82

–0,87

–0,92

–0,95

–0,99

–0,80

–0,82

–0,87

–0,90

–0,94

–0,74

–0,78

–0,82

–0,84

–0,88

–0,69

–0,73

–0,76

–0,79

–0,82

–0,64

–0,67

–0,71

–0,73

–0,75

–0,59

–0,62

–0,65

–0,67

–0,69

–0,71

–0,72

–0,73

–0,74

–0,75

–0,54

–0,57

–0,59

–0,61

–0,63

–0,64

–0,65

–0,66

–0,67

–0,68

–0,67

–0,49

–0,51

–0,53

–0,55

–0,56

–0,57

–0,58

–0,59

–0,60

–0,61

–0,60

–0,43

–0,45

–0,47

–0,48

–0,50

–0,51

–0,52

–0,53

–0,38

–0,39

–0,40

–0,42

–0,43

–0,44

–0,45

–0,46

–0,45

–0,32

–0,33

–0,34

–0,35

–0,36

–0,37

–0,38

–0,26

–0,27

–0,28

–0,29

–0,30

–0,31

–0,30

–0,20

–0,21

–0,22

–0,23

–0,13

–0,14

–0,15

–0,07

–0,08

R É F É R E N

C E

+0,07

+0,08

+0,14

+0,15

+0,16

+0,15

+0,21

+0,22

+0,23

+0,24

+0,23

+0,29

+0,30

+0,31

+0,32

+0,31

+0,36

+0,37

+0,38

+0,39

+0,40

+0,39

+0,44

+0,45

+0,46

+0,47

+0,48

+0,47

+0,46

+0,52

+0,53

+0,54

+0,55

+0,56

+0,55

+0,54

+0,60

+0,61

+0,62

+0,63

+0,64

+0,65

+0,64

+0,63

+0,62

+0,68

+0,69

+0,70

+0,71

+0,72

+0,73

+0,72

+0,71

+0,70

+0,77

+0,78

+0,79

+0,80

+0,81

+0,82

+0,81

+0,80

+0,79

+0,78

+0,85

+0,87

+0,88

+0,89

+0,90

+0,89

+0,88

+0,87

+0,86

+0,94

+0,95

+0,96

+0,97

+0,98

+0,99

+0,98

+0,97

+0,96

+0,95

+0,94

+1,03

+1,04

+1,05

+1,06

+1,07

+1,08

+1,07

+1,06

+1,05

+1,03

+1,02

+1,12

+1,19

+1,15

+1,16

+1,17

+1,16

+1,15

+1,14

+1,13

+1,12

+1,10

+1,22

+1,23

+1,24

+1,25

+1,26

+1,25

+1,24

+1,23

+1,21

+1,20

+1,18

+1,31

+1,32

+1,33

+1,34

+1,35

+1,34

+1,33

+1,32

+1,30

+1,28

+1,26

+1,41

+1,42

+1,43

+1,44

+1,43

+1,42

+1,40

+1,38

+1,36

+1,34

+1,51

+1,52

+1,53

+1,54

+1,53

+1,52

+1,51

+1,49

+1,47

+1,45

+1,42

+1,61

+1,62

+1,63

+1,62

+1,61

+1,60

+1,58

+1,56

+1,53

+1,50

+1,71

+1,72

+1,73

+1,72

+1,71

+1,70

+1,69

+1,67

+1,64

+1,62

+1,59

It is preferable that the variations in temperature in relation to 20°C do not exceed  5°C.

TABLE II

Table giving the sugar content of musts and concentrated musts in grammes per litre and in grammes per kilogramme, determined using a graduated refractometer, either in percentage by mass of saccharose at 20°C, or refractive index at 20°C. The mass density at 20°C is also given.

Saccharose	Refractive Index	Mass	Sugars in	Sugars in	ABV % vol at 20 °C
% (m/m)	at 20 °C	Density at 20 °C	g/l	g/kg	at 20 °C
10.0	1.34782	1.0391	82.2	79.1	4.89
10.1	1.34798	1.0395	83.3	80.1	4.95
10.2	1.34813	1.0399	84.3	81.1	5.01
10.3	1.34829	1.0403	85.4	82.1	5.08
10.4	1.34844	1.0407	86.5	83.1	5.14
10.5	1.34860	1.0411	87.5	84.1	5.20
10.6	1.34875	1.0415	88.6	85.0	5.27
10.7	1.34891	1.0419	89.6	86.0	5.32
10.8	1.34906	1.0423	90.7	87.0	5.39
10.9	1.34922	1.0427	91.8	88.0	5.46
11.0	1.34937	1.0431	92.8	89.0	5.52
11.1	1.34953	1.0436	93.9	90.0	5.58
11.2	1.34968	1.0440	95.0	91.0	5.65
11.3	1.34984	1.0444	96.0	92.0	5.71
11.4	1.34999	1.0448	97.1	92.9	5.77
11.5	1.35015	1.0452	98.2	93.9	5.84
11.6	1.35031	1.0456	99.3	94.9	5.90
11.7	1.35046	1.0460	100.3	95.9	5.96
11.8	1.35062	1.0464	101.4	96.9	6.03
11.9	1.35077	1.0468	102.5	97.9	6.09
12.0	1.35093	1.0472	103.5	98.9	6.15
12.1	1.35109	1.0477	104.6	99.9	6.22
12.2	1.35124	1.0481	105.7	100.8	6.28
12.3	1.35140	1.0485	106.8	101.8	6.35
12.4	1.35156	1.0489	107.8	102.8	6.41
12.5	1.35171	1.0493	108.9	103.8	6.47
12.6	1.35187	1.0497	110.0	104.8	6.54
12.7	1.35203	1.0501	111.1	105.8	6.60
12.8	1.35219	1.0506	112.2	106.8	6.67
12.9	1.35234	1.0510	113.2	107.8	6.73
13.0	1.35250	1.0514	114.3	108.7	6.79
13.1	1.35266	1.0518	115.4	109.7	6.86
13.2	1.35282	1.0522	116.5	110.7	6.92
13.3	1.35298	1.0527	117.6	111.7	6.99
13.4	1.35313	1.0531	118.7	112.7	7.05
13.5	1.35329	1.0535	119.7	113.7	7.11
13.6	1.35345	1.0539	120.8	114.7	7.18
13.7	1.35361	1.0543	121.9	115.6	7.24
13.8	1.35377	1.0548	123.0	116.6	7.31
13.9	1.35393	1.0552	124.1	117.6	7.38
14.0	1.35408	1.0556	125.2	118.6	7.44
14.1	1.35424	1.0560	126.3	119.6	7.51
14.2	1.35440	1.0564	127.4	120.6	7.57
14.3	1.35456	1.0569	128.5	121.6	7.64
14.4	1.35472	1.0573	129.6	122.5	7.70
14.5	1.35488	1.0577	130.6	123.5	7.76
14.6	1.35504	1.0581	131.7	124.5	7.83
14.7	1.35520	1.0586	132.8	125.5	7.89
14.8	1.35536	1.0590	133.9	126.5	7.96
14.9	1.35552	1.0594	135.0	127.5	8.02

TABLE II - (continued)

Saccharose	Refractive Index	Mass	Sugars in	Sugars in	ABV % vol at 20 °C
% (m/m)	at 20 °C	Density at 20 °C	g/l	g/kg	at 20 °C
15.0	1.35568	1.0598	136.1	128.4	8.09
15.1	1.35584	1.0603	137.2	129.4	8.15
15.2	1.35600	1.0607	138.3	130.4	8.22
15.3	1.35616	1.0611	139.4	131.4	8.28
15.4	1.35632	1.0616	140.5	132.4	8.35
15.5	1.35648	1.0620	141.6	133.4	8.42
15.6	1.35664	1.0624	142.7	134.3	8.48
15.7	1.35680	1.0628	143.8	135.3	8.55
15.8	1.35696	1.0633	144.9	136.3	8.61
15.9	1.35713	1.0637	146.0	137.3	8.68
16.0	1.35729	1.0641	147.1	138.3	8.74
16.1	1.35745	1.0646	148.2	139.3	8.81
16.2	1.35761	1.0650	149.3	140.2	8.87
16.3	1.35777	1.0654	150.5	141.2	8.94
16.4	1.35793	1.0659	151.6	142.2	9.01
16.5	1.35810	1.0663	152.7	143.2	9.07
16.6	1.35826	1.0667	153.8	144.2	9.14
16.7	1.35842	1.0672	154.9	145.1	9.21
16.8	1.35858	1.0676	156.0	146.1	9.27
16.9	1.35874	1.0680	157.1	147.1	9.34
17.0	1.35891	1.0685	158.2	148.1	9.40
17.1	1.35907	1.0689	159.3	149.1	9.47
17.2	1.35923	1.0693	160.4	150.0	9.53
17.3	1.35940	1.0698	161.6	151.0	9.60
17.4	1.35956	1.0702	162.7	152.0	9.67
17.5	1.35972	1.0707	163.8	153.0	9.73
17.6	1.35989	1.0711	164.9	154.0	9.80
17.7	1.36005	1.0715	166.0	154.9	9.87
17.8	1.36021	1.0720	167.1	155.9	9.93
17.9	1.36038	1.0724	168.3	156.9	10.00
18.0	1.36054	1.0729	169.4	157.9	10.07
18.1	1.36070	1.0733	170.5	158.9	10.13
18.2	1.36087	1.0737	171.6	159.8	10.20
18.3	1.36103	1.0742	172.7	160.8	10.26
18.4	1.36120	1.0746	173.9	161.8	10.33
18.5	1.36136	1.0751	175.0	162.8	10.40
18.6	1.36153	1.0755	176.1	163.7	10.47
18.7	1.36169	1.0760	177.2	164.7	10.53
18.8	1.36185	1.0764	178.4	165.7	10.60
18.9	1.36202	1.0768	179.5	166.7	10.67
19.0	1.36219	1.0773	180.6	167.6	10.73
19.1	1.36235	1.0777	181.7	168.6	10.80
19.2	1.36252	1.0782	182.9	169.6	10.87
19.3	1.36268	1.0786	184.0	170.6	10.94
19.4	1.36285	1.0791	185.1	171.5	11.00
19.5	1.36301	1.0795	186.2	172.5	11.07
19.6	1.36318	1.0800	187.4	173.5	11.14
19.7	1.36334	1.0804	188.5	174.5	11.20
19.8	1.36351	1.0809	189.6	175.4	11.27
19.9	1.36368	1.0813	190.8	176.4	11.34

TABLE II - (continued

Saccharose	Refractive Index	Mass	Sugars in	Sugars in	ABV % vol at 20 °C
% (m/m)	at 20 °C	Density at 20 °C	g/l	g/kg	at 20 °C
20.0	1.36384	1.0818	191.9	177.4	11.40
20.1	1.36401	1.0822	193.0	178.4	11.47
20.2	1.36418	1.0827	194.2	179.3	11.54
20.3	1.36434	1.0831	195.3	180.3	11.61
20.4	1.36451	1.0836	196.4	181.3	11.67
20.5	1.36468	1.0840	197.6	182.3	11.74
20.6	1.36484	1.0845	198.7	183.2	11.81
20.7	1.36501	1.0849	199.8	184.2	11.87
20.8	1.36518	1.0854	201.0	185.2	11.95
20.9	1.36535	1.0858	202.1	186.1	12.01
21.0	1.36551	1.0863	203.3	187.1	12.08
21.1	1.36568	1.0867	204.4	188.1	12.15
21.2	1.36585	1.0872	205.5	189.1	12.21
21.3	1.36602	1.0876	206.7	190.0	12.28
21.4	1.36619	1.0881	207.8	191.0	12.35
21.5	1.36635	1.0885	209.0	192.0	12.42
21.6	1.36652	1.0890	210.1	192.9	12.49
21.7	1.36669	1.0895	211.3	193.9	12.56
21.8	1.36686	1.0899	212.4	194.9	12.62
21.9	1.36703	1.0904	213.6	195.9	12.69
22.0	1.36720	1.0908	214.7	196.8	12.76
22.1	1.36737	1.0913	215.9	197.8	12.83
22.2	1.36754	1.0917	217.0	198.8	12.90
22.3	1.36771	1.0922	218.2	199.7	12.97
22.4	1.36787	1.0927	219.3	200.7	13.03
22.5	1.36804	1.0931	220.5	201.7	13.10
22.6	1.36821	1.0936	221.6	202.6	13.17
22.7	1.36838	1.0940	222.8	203.6	13.24
22.8	1.36855	1.0945	223.9	204.6	13.31
22.9	1.36872	1.0950	225.1	205.5	13.38
23.0	1.36889	1.0954	226.2	206.5	13.44
23.1	1.36906	1.0959	227.4	207.5	13.51
23.2	1.36924	1.0964	228.5	208.4	13.58
23.3	1.36941	1.0968	229.7	209.4	13.65
23.4	1.36958	1.0973	230.8	210.4	13.72
23.5	1.36975	1.0977	232.0	211.3	13.79
23.6	1.36992	1.0982	233.2	212.3	13.86
23.7	1.37009	1.0987	234.3	213.3	13.92
23.8	1.37026	1.0991	235.5	214.2	14.00
23.9	1.37043	1.0996	236.6	215.2	14.06
24.0	1.37060	1.1001	237.8	216.2	14.13
24.1	1.37078	1.1005	239.0	217.1	14.20
24.2	1.37095	1.1010	240.1	218.1	14.27
24.3	1.37112	1.1015	241.3	219.1	14.34
24.4	1.37129	1.1019	242.5	220.0	14.41
24.5	1.37146	1.1024	243.6	221.0	14.48
24.6	1.37164	1.1029	244.8	222.0	14.55
24.7	1.37181	1.1033	246.0	222.9	14.62
24.8	1.37198	1.1038	247.1	223.9	14.69
24.9	1.37216	1.1043	248.3	224.8	14.76

TABLE II - (continued

TABLE II - (continued)

Saccharose	Refractive Index	Mass	Sugars in	Sugars in	ABV % vol at 20 °C
% (m/m)	at 20 °C	Density at 20 °C	g/l	g/kg	at 20 °C
35.0	1.39032	1.1537	370.5	321.1	22.02
35.1	1.39051	1.1542	371.8	322.1	22.10
35.2	1.39070	1.1547	373.0	323.0	22.17
35.3	1.39088	1.1552	374.3	324.0	22.24
35.4	1.39107	1.1557	375.5	324.9	22.32
35.5	1.39126	1.1563	376.8	325.9	22.39
35.6	1.39145	1.1568	378.0	326.8	22.46
35.7	1.39164	1.1573	379.3	327.8	22.54
35.8	1.39182	1.1578	380.6	328.7	22.62
35.9	1.39201	1.1583	381.8	329.6	22.69
36.0	1.39220	1.1588	383.1	330.6	22.77
36.1	1.39239	1.1593	384.4	331.5	22.84
36.2	1.39258	1.1598	385.6	332.5	22.92
36.3	1.39277	1.1603	386.9	333.4	22.99
36.4	1.39296	1.1609	388.1	334.4	23.06
36.5	1.39314	1.1614	389.4	335.3	23.14
36.6	1.39333	1.1619	390.7	336.3	23.22
36.7	1.39352	1.1624	392.0	337.2	23.30
36.8	1.39371	1.1629	393.2	338.1	23.37
36.9	1.39390	1.1634	394.5	339.1	23.45
37.0	1.39409	1.1640	395.8	340.0	23.52
37.1	1.39428	1.1645	397.0	341.0	23.59
37.2	1.39447	1.1650	398.3	341.9	23.67
37.3	1.39466	1.1655	399.6	342.9	23.75
37.4	1.39485	1.1660	400.9	343.8	23.83
37.5	1.39504	1.1665	402.1	344.7	23.90
37.6	1.39524	1.1671	403.4	345.7	23.97
37.7	1.39543	1.1676	404.7	346.6	24.05
37.8	1.39562	1.1681	406.0	347.6	24.13
37.9	1.39581	1.1686	407.3	348.5	24.21
38.0	1.39600	1.1691	408.6	349.4	24.28
38.1	1.39619	1.1697	409.8	350.4	24.35
38.2	1.39638	1.1702	411.1	351.3	24.43
38.3	1.39658	1.1707	412.4	352.3	24.51
38.4	1.39677	1.1712	413.7	353.2	24.59
38.5	1.39696	1.1717	415.0	354.2	24.66
38.6	1.39715	1.1723	416.3	355.1	24.74
38.7	1.39734	1.1728	417.6	356.0	24.82
38.8	1.39754	1.1733	418.8	357.0	24.89
38.9	1.39773	1.1738	420.1	357.9	24.97
39.0	1.39792	1.1744	421.4	358.9	25.04
39.1	1.39812	1.1749	422.7	359.8	25.12
39.2	1.39831	1.1754	424.0	360.7	25.20
39.3	1.39850	1.1759	425.3	361.7	25.28
39.4	1.39870	1.1765	426.6	362.6	25.35
39.5	1.39889	1.1770	427.9	363.6	25.43
39.6	1.39908	1.1775	429.2	364.5	25.51
39.7	1.39928	1.1780	430.5	365.4	25.58
39.8	1.39947	1.1786	431.8	366.4	25.66
39.9	1.39967	1.1791	433.1	367.3	25.74

TABLE II - (continued)

Saccharose	Refractive Index	Mass	Sugars in	Sugars in	ABV % vol at 20 °C
% (m/m)	at 20 °C	Density at 20 °C	g/l	g/kg	at 20 °C
40.0	1.39986	1.1796	434.4	368.3	25.82
40.1	1.40006	1.1801	435.7	369.2	25.89
40.2	1.40025	1.1807	437.0	370.1	25.97
40.3	1.40044	1.1812	438.3	371.1	26.05
40.4	1.40064	1.1817	439.6	372.0	26.13
40.5	1.40083	1.1823	440.9	373.0	26.20
40.6	1.40103	1.1828	442.2	373.9	26.28
40.7	1.40123	1.1833	443.6	374.8	26.36
40.8	1.40142	1.1839	444.9	375.8	26.44
40.9	1.40162	1.1844	446.2	376.7	26.52
41.0	1.40181	1.1849	447.5	377.7	26.59
41.1	1.40201	1.1855	448.8	378.6	26.67
41.2	1.40221	1.1860	450.1	379.5	26.75
41.3	1.40240	1.1865	451.4	380.5	26.83
41.4	1.40260	1.1871	452.8	381.4	26.91
41.5	1.40280	1.1876	454.1	382.3	26.99
41.6	1.40299	1.1881	455.4	383.3	27.06
41.7	1.40319	1.1887	456.7	384.2	27.14
41.8	1.40339	1.1892	458.0	385.2	27.22
41.9	1.40358	1.1897	459.4	386.1	27.30
42.0	1.40378	1.1903	460.7	387.0	27.38
42.1	1.40398	1.1908	462.0	388.0	27.46
42.2	1.40418	1.1913	463.3	388.9	27.53
42.3	1.40437	1.1919	464.7	389.9	27.62
42.4	1.40457	1.1924	466.0	390.8	27.69
42.5	1.40477	1.1929	467.3	391.7	27.77
42.6	1.40497	1.1935	468.6	392.7	27.85
42.7	1.40517	1.1940	470.0	393.6	27.93
42.8	1.40537	1.1946	471.3	394.5	28.01
42.9	1.40557	1.1951	472.6	395.5	28.09
43.0	1.40576	1.1956	474.0	396.4	28.17
43.1	1.40596	1.1962	475.3	397.3	28.25
43.2	1.40616	1.1967	476.6	398.3	28.32
43.3	1.40636	1.1973	478.0	399.2	28.41
43.4	1.40656	1.1978	479.3	400.2	28.48
43.5	1.40676	1.1983	480.7	401.1	28.57
43.6	1.40696	1.1989	482.0	402.0	28.65
43.7	1.40716	1.1994	483.3	403.0	28.72
43.8	1.40736	1.2000	484.7	403.9	28.81
43.9	1.40756	1.2005	486.0	404.8	28.88
44.0	1.40776	1.2011	487.4	405.8	28.97
44.1	1.40796	1.2016	488.7	406.7	29.04
44.2	1.40817	1.2022	490.1	407.6	29.13
44.3	1.40837	1.2027	491.4	408.6	29.20
44.4	1.40857	1.2032	492.8	409.5	29.29
44.5	1.40877	1.2038	494.1	410.4	29.36
44.6	1.40897	1.2043	495.5	411.4	29.45
44.7	1.40917	1.2049	496.8	412.3	29.52
44.8	1.40937	1.2054	498.2	413.3	29.61
44.9	1.40958	1.2060	499.5	414.2	29.69

TABLE II (continued)

Saccharose

Refractive Index

Mass

Sugars in

ABV % vol

at 20 °C

TABLE II - (continued)

Saccharose	Refractive Index	Mass	Sugars in	Sugars in	ABV % vol at 20 °C
% (m/m)	at 20 °C	Density at 20 °C	g/l	g/kg	at 20 °C
60.0	1.44193	1.2937	716.6	553.9	42.59
60.1	1.44216	1.2943	718.1	554.8	42.68
60.2	1.44238	1.2949	719.6	555.7	42.77
60.3	1.44261	1.2956	721.1	556.6	42.85
60.4	1.44284	1.2962	722.7	557.5	42.95
60.5	1.44306	1.2968	724.2	558.4	43.04
60.6	1.44329	1.2974	725.7	559.4	43.13
60.7	1.44352	1.2980	727.3	560.3	43.22
60.8	1.44375	1.2986	728.8	561.2	43.31
60.9	1.44398	1.2993	730.3	562.1	43.40
61.0	1.44420	1.2999	731.8	563.0	43.49
61.1	1.44443	1.3005	733.4	563.9	43.59
61.2	1.44466	1.3011	734.9	564.8	43.68
61.3	1.44489	1.3017	736.4	565.7	43.76
61.4	1.44512	1.3024	738.0	566.6	43.86
61.5	1.44535	1.3030	739.5	567.6	43.95
61.6	1.44558	1.3036	741.1	568.5	44.04
61.7	1.44581	1.3042	742.6	569.4	44.13
61.8	1.44604	1.3049	744.1	570.3	44.22
61.9	1.44627	1.3055	745.7	571.2	44.32
62.0	1.44650	1.3061	747.2	572.1	44.41
62.1	1.44673	1.3067	748.8	573.0	44.50
62.2	1.44696	1.3074	750.3	573.9	44.59
62.3	1.44719	1.3080	751.9	574.8	44.69
62.4	1.44742	1.3086	753.4	575.7	44.77
62.5	1.44765	1.3092	755.0	576.6	44.87
62.6	1.44788	1.3099	756.5	577.5	44.96
62.7	1.44811	1.3105	758.1	578.5	45.05
62.8	1.44834	1.3111	759.6	579.4	45.14
62.9	1.44858	1.3118	761.2	580.3	45.24
63.0	1.44881	1.3124	762.7	581.2	45.33
63.1	1.44904	1.3130	764.3	582.1	45.42
63.2	1.44927	1.3137	765.8	583.0	45.51
63.3	1.44950	1.3143	767.4	583.9	45.61
63.4	1.44974	1.3149	769.0	584.8	45.70
63.5	1.44997	1.3155	770.5	585.7	45.79
63.6	1.45020	1.3162	772.1	586.6	45.89
63.7	1.45043	1.3168	773.6	587.5	45.98
63.8	1.45067	1.3174	775.2	588.4	46.07
63.9	1.45090	1.3181	776.8	589.3	46.17
64.0	1.45113	1.3187	778.3	590.2	46.25
64.1	1.45137	1.3193	779.9	591.1	46.35
64.2	1.45160	1.3200	781.5	592.0	46.44
64.3	1.45184	1.3206	783.0	592.9	46.53
64.4	1.45207	1.3213	784.6	593.8	46.63
64.5	1.45230	1.3219	786.2	594.7	46.72
64.6	1.45254	1.3225	787.8	595.6	46.82
64.7	1.45277	1.3232	789.3	596.5	46.91
64.8	1.45301	1.3238	790.9	597.4	47.00
64.9	1.45324	1.3244	792.5	598.3	47.10

TABLE II - (continued)

Saccharose	Refractive Index	Mass	Sugars in	Sugars in	ABV % vol at 20 °C
% (m/m)	at 20 °C	Density at 20 °C	g/l	g/kg	at 20 °C
70.0	1.46546	1.3576	874.5	644.1	51.97
70.1	1.46570	1.3583	876.1	645.0	52.07
70.2	1.46594	1.3590	877.7	645.9	52.16
70.3	1.46619	1.3596	879.4	646.8	52.26
70.4	1.46643	1.3603	881.0	647.7	52.36
70.5	1.46668	1.3610	882.7	648.5	52.46
70.6	1.46692	1.3616	884.3	649.4	52.55
70.7	1.46717	1.3623	886.0	650.3	52.65
70.8	1.46741	1.3630	887.6	651.2	52.75
70.9	1.46766	1.3636	889.3	652.1	52.85
71.0	1.46790	1.3643	890.9	653.0	52.95
71.1	1.46815	1.3650	892.6	653.9	53.05
71.2	1.46840	1.3656	894.2	654.8	53.14
71.3	1.46864	1.3663	895.9	655.7	53.24
71.4	1.46889	1.3670	897.5	656.6	53.34
71.5	1.46913	1.3676	899.2	657.5	53.44
71.6	1.46938	1.3683	900.8	658.3	53.53
71.7	1.46963	1.3690	902.5	659.2	53.64
71.8	1.46987	1.3696	904.1	660.1	53.73
71.9	1.47012	1.3703	905.8	661.0	53.83
72.0	1.47037	1.3710	907.5	661.9	53.93
72.1	1.47062	1.3717	909.1	662.8	54.03
72.2	1.47086	1.3723	910.8	663.7	54.13
72.3	1.47111	1.3730	912.5	664.6	54.23
72.4	1.47136	1.3737	914.1	665.5	54.32
72.5	1.47161	1.3743	915.8	666.3	54.43
72.6	1.47186	1.3750	917.5	667.2	54.53
72.7	1.47210	1.3757	919.1	668.1	54.62
72.8	1.47235	1.3764	920.8	669.0	54.72
72.9	1.47260	1.3770	922.5	669.9	54.82
73.0	1.47285	1.3777	924.2	670.8	54.93
73.1	1.47310	1.3784	925.8	671.7	55.02
73.2	1.47335	1.3791	927.5	672.6	55.12
73.3	1.47360	1.3797	929.2	673.5	55.22
73.4	1.47385	1.3804	930.9	674.3	55.32
73.5	1.47410	1.3811	932.6	675.2	55.42
73.6	1.47435	1.3818	934.3	676.1	55.53
73.7	1.47460	1.3825	935.9	677.0	55.62
73.8	1.47485	1.3831	937.6	677.9	55.72
73.9	1.47510	1.3838	939.3	678.8	55.82
74.0	1.47535	1.3845	941.0	679.7	55.92
74.1	1.47560	1.3852	942.7	680.6	56.02
74.2	1.47585	1.3859	944.4	681.4	56.13
74.3	1.47610	1.3865	946.1	682.3	56.23
74.4	1.47635	1.3872	947.8	683.2	56.33
74.5	1.47661	1.3879	949.5	684.1	56.43
74.6	1.47686	1.3886	951.2	685.0	56.53
74.7	1.47711	1.3893	952.9	685.9	56.63
74.8	1.47736	1.3899	954.6	686.8	56.73
74.9	1.47761	1.3906	956.3	687.7	56.83

TABLE III: Table giving the sugar concentration in rectified concentrated must

in grams per liter and grams per kilogram.

determined by means of a refractometer graduated

either in percentage by mass of sucrose at 20°C

or in refractive index at 20°C.

TABLE III

Saccharose % (m/m)	Refractive Index at 20 °C	Mass Density at 20 °C	Sugars in g/l	Sugars in g/kg	ABV % vol at 20 °C
50.0	1.42008	1.2342	627.6	508.5	37.30
50.1	1.42029	1.2348	629.3	509.6	37.40
50.2	1.42050	1.2355	630.9	510.6	37.49
50.3	1.42071	1.2362	632.4	511.6	37.58
50.4	1.42092	1.2367	634.1	512.7	37.68
50.5	1.42113	1.2374	635.7	513.7	37.78
50.6	1.42135	1.2381	637.3	514.7	37.87
50.7	1.42156	1.2386	638.7	515.7	37.96
50.8	1.42177	1.2391	640.4	516.8	38.06
50.9	1.42198	1.2396	641.9	517.8	38.15
51.0	1.42219	1.2401	643.4	518.8	38.24
51.1	1.42240	1.2406	645.0	519.9	38.33
51.2	1.42261	1.2411	646.5	520.9	38.42
51.3	1.42282	1.2416	648.1	522.0	38.52
51.4	1.42304	1.2421	649.6	523.0	38.61
51.5	1.42325	1.2427	651.2	524.0	38.70
51.6	1.42347	1.2434	652.9	525.1	38.80
51.7	1.42368	1.2441	654.5	526.1	38.90
51.8	1.42389	1.2447	656.1	527.1	38.99
51.9	1.42410	1.2454	657.8	528.2	39.09
52.0	1.42432	1.2461	659.4	529.2	39.19
52.1	1.42453	1.2466	661.0	530.2	39.28
52.2	1.42475	1.2470	662.5	531.3	39.37
52.3	1.42496	1.2475	664.1	532.3	39.47
52.4	1.42517	1.2480	665.6	533.3	39.56
52.5	1.42538	1.2486	667.2	534.4	39.65
52.6	1.42560	1.2493	668.9	535.4	39.75
52.7	1.42581	1.2500	670.5	536.4	39.85
52.8	1.42603	1.2506	672.2	537.5	39.95
52.9	1.42624	1.2513	673.8	538.5	40.04
53.0	1.42645	1.2520	675.5	539.5	40.14
53.1	1.42667	1.2525	677.1	540.6	40.24
53.2	1.42689	1.2530	678.5	541.5	40.32
53.3	1.42711	1.2535	680.2	542.6	40.42
53.4	1.42733	1.2540	681.8	543.7	40.52
53.5	1.42754	1.2546	683.4	544.7	40.61
53.6	1.42776	1.2553	685.1	545.8	40.72
53.7	1.42797	1.2560	686.7	546.7	40.81
53.8	1.42819	1.2566	688.4	547.8	40.91
53.9	1.42840	1.2573	690.1	548.9	41.01
54.0	1.42861	1.2580	691.7	549.8	41.11
54.1	1.42884	1.2585	693.3	550.9	41.20
54.2	1.42906	1.2590	694.9	551.9	41.30
54.3	1.42927	1.2595	696.5	553.0	41.39
54.4	1.42949	1.2600	698.1	554.0	41.49
54.5	1.42971	1.2606	699.7	555.1	41.58
54.6	1.42993	1.2613	701.4	556.1	41.68
54.7	1.43014	1.2620	703.1	557.1	41.79
54.8	1.43036	1.2625	704.7	558.2	41.88
54.9	1.43058	1.2630	706.2	559.1	41.97

TABLE III (continued)

Saccharose % (m/m)	Refractive Index at 20 °C	Mass Density at 20 °C	Sugars in g/l	Sugars in g/kg	ABV % vol at 20 °C
55.0	1.43079	1.2635	707.8	560.2	42.06
55.1	1.43102	1.2639	709.4	561.3	42.16
55.2	1.43124	1.2645	711.0	562.3	42.25
55.3	1.43146	1.2652	712.7	563.3	42.36
55.4	1.43168	1.2659	714.4	564.3	42.46
55.5	1.43189	1.2665	716.1	565.4	42.56
55.6	1.43211	1.2672	717.8	566.4	42.66
55.7	1.43233	1.2679	719.5	567.5	42.76
55.8	1.43255	1.2685	721.1	568.5	42.85
55.9	1.43277	1.2692	722.8	569.5	42.96
56.0	1.43298	1.2699	724.5	570.5	43.06
56.1	1.43321	1.2703	726.1	571.6	43.15
56.2	1.43343	1.2708	727.7	572.6	43.25
56.3	1.43365	1.2713	729.3	573.7	43.34
56.4	1.43387	1.2718	730.9	574.7	43.44
56.5	1.43409	1.2724	732.6	575.8	43.54
56.6	1.43431	1.2731	734.3	576.8	43.64
56.7	1.43454	1.2738	736.0	577.8	43.74
56.8	1.43476	1.2744	737.6	578.8	43.84
56.9	1.43498	1.2751	739.4	579.9	43.94
57.0	1.43519	1.2758	741.1	580.9	44.04
57.1	1.43542	1.2763	742.8	582.0	44.14
57.2	1.43564	1.2768	744.4	583.0	44.24
57.3	1.43586	1.2773	745.9	584.0	44.33
57.4	1.43609	1.2778	747.6	585.1	44.43
57.5	1.43631	1.2784	749.3	586.1	44.53
57.6	1.43653	1.2791	751.0	587.1	44.63
57.7	1.43675	1.2798	752.7	588.1	44.73
57.8	1.43698	1.2804	754.4	589.2	44.83
57.9	1.43720	1.2810	756.1	590.2	44.94
58.0	1.43741	1.2818	757.8	591.2	45.04
58.1	1.43764	1.2822	759.5	592.3	45.14
58.2	1.43784	1.2827	761.1	593.4	45.23
58.3	1.43909	1.2832	762.6	594.3	45.32
58.4	1.43832	1.2837	764.3	595.4	45.42
58.5	1.43854	1.2843	766.0	596.4	45.52
58.6	1.43877	1.2850	767.8	597.5	45.63
58.7	1.43899	1.2857	769.5	598.5	45.73
58.8	1.43922	1.2863	771.1	599.5	45.83
58.9	1.43944	1.2869	772.9	600.6	45.93
59.0	1.43966	1.2876	774.6	601.6	46.03
59.1	1.43988	1.2882	776.3	602.6	46.14
59.2	1.44011	1.2889	778.1	603.7	46.24
59.3	1.44034	1.2896	779.8	604.7	46.34
59.4	1.44057	1.2902	781.6	605.8	46.45
59.5	1.44079	1.2909	783.3	606.8	46.55
59.6	1.44102	1.2916	785.2	607.9	46.66
59.7	1.44124	1.2921	786.8	608.9	46.76
59.8	1.44147	1.2926	788.4	609.9	46.85
59.9	1.44169	1.2931	790.0	610.9	46.95

Saccharose % (m/m)	Refractive Index at 20 °C	Mass Density at 20 °C	Sugars in g/l	Sugars in g/kg	ABV % vol at 20 °C
65.0	1.45347	1.3248	879.7	664.0	52.28
65.1	1.45369	1.3255	881.5	665.0	52.39
65.2	1.45393	1.3261	883.2	666.0	52.49
65.3	1.45416	1.3268	885.0	667.0	52.60
65.4	1.45440	1.3275	886.9	668.1	52.71
65.5	1.45463	1.3281	888.8	669.2	52.82
65.6	1.45487	1.3288	890.6	670.2	52.93
65.7	1.45510	1.3295	892.4	671.2	53.04
65.8	1.45534	1.3301	894.2	672.3	53.14
65.9	1.45557	1.3308	896.0	673.3	53.25
66.0	1.45583	1.3315	898.0	674.4	53.37
66.1	1.45605	1.3320	899.6	675.4	53.46
66.2	1.45629	1.3325	901.3	676.4	53.56
66.3	1.45652	1.3330	903.1	677.5	53.67
66.4	1.45676	1.3335	904.8	678.5	53.77
66.5	1.45700	1.3341	906.7	679.6	53.89
66.6	1.45724	1.3348	908.5	680.6	53.99
66.7	1.45747	1.3355	910.4	681.7	54.11
66.8	1.45771	1.3361	912.2	682.7	54.21
66.9	1.45795	1.3367	913.9	683.7	54.31
67.0	1.45820	1.3374	915.9	684.8	54.43
67.1	1.45843	1.3380	917.6	685.8	54.53
67.2	1.45867	1.3387	919.6	686.9	54.65
67.3	1.45890	1.3395	921.4	687.9	54.76
67.4	1.45914	1.3400	923.1	688.9	54.86
67.5	1.45938	1.3407	925.1	690.0	54.98
67.6	1.45962	1.3415	927.0	691.0	55.09
67.7	1.45986	1.3420	928.8	692.1	55.20
67.8	1.46010	1.3427	930.6	693.1	55.31
67.9	1.46034	1.3434	932.6	694.2	55.42
68.0	1.46060	1.3440	934.4	695.2	55.53
68.1	1.46082	1.3447	936.2	696.2	55.64
68.2	1.46106	1.3454	938.0	697.2	55.75
68.3	1.46130	1.3460	939.9	698.3	55.86
68.4	1.46154	1.3466	941.8	699.4	55.97
68.5	1.46178	1.3473	943.7	700.4	56.08
68.6	1.46202	1.3479	945.4	701.4	56.19
68.7	1.46226	1.3486	947.4	702.5	56.30
68.8	1.46251	1.3493	949.2	703.5	56.41
68.9	1.46275	1.3499	951.1	704.6	56.52
69.0	1.46301	1.3506	953.0	705.6	56.64
69.1	1.46323	1.3513	954.8	706.6	56.74
69.2	1.46347	1.3519	956.7	707.7	56.86
69.3	1.46371	1.3526	958.6	708.7	56.97
69.4	1.46396	1.3533	960.6	709.8	57.09
69.5	1.46420	1.3539	962.4	710.8	57.20
69.6	1.46444	1.3546	964.3	711.9	57.31
69.7	1.46468	1.3553	966.2	712.9	57.42
69.8	1.46493	1.3560	968.2	714.0	57.54
69.9	1.46517	1.3566	970.0	715.0	57.65

Saccharose % (m/m)	Refractive Index at 20 °C	Mass Density à 20 °C	Sugars in g/l	Sugars in g/kg	ABV % vol at 20 °C
70.0	1.46544	1.3573	971.8	716.0	57.75
70.1	1.46565	1.3579	973.8	717.1	57.87
70.2	1.46590	1.3586	975.6	718.1	57.98
70.3	1.46614	1.3593	977.6	719.2	58.10
70.4	1.46639	1.3599	979.4	720.2	58.21
70.5	1.46663	1.3606	981.3	721.2	58.32
70.6	1.46688	1.3613	983.3	722.3	58.44
70.7	1.46712	1.3619	985.2	723.4	58.55
70.8	1.46737	1.3626	987.1	724.4	58.66
70.9	1.46761	1.3633	988.9	725.4	58.77
71.0	1.46789	1.3639	990.9	726.5	58.89
71.1	1.46810	1.3646	992.8	727.5	59.00
71.2	1.46835	1.3653	994.8	728.6	59.12
71.3	1.46859	1.3659	996.6	729.6	59.23
71.4	1.46884	1.3665	998.5	730.7	59.34
71.5	1.46908	1.3672	1000.4	731.7	59.45
71.6	1.46933	1.3678	1002.2	732.7	59.56
71.7	1.46957	1.3685	1004.2	733.8	59.68
71.8	1.46982	1.3692	1006.1	734.8	59.79
71.9	1.47007	1.3698	1008.0	735.9	59.91
72.0	1.47036	1.3705	1009.9	736.9	60.02
72.1	1.47056	1.3712	1012.0	738.0	60.14
72.2	1.47081	1.3718	1013.8	739.0	60.25
72.3	1.47106	1.3725	1015.7	740.0	60.36
72.4	1.47131	1.3732	1017.7	741.1	60.48
72.5	1.47155	1.3738	1019.5	742.1	60.59
72.6	1.47180	1.3745	1021.5	743.2	60.71
72.7	1.47205	1.3752	1023.4	744.2	60.82
72.8	1.47230	1.3758	1025.4	745.3	60.94
72.9	1.47254	1.3765	1027.3	746.3	61.05
73.0	1.47284	1.3772	1029.3	747.4	61.17
73.1	1.47304	1.3778	1031.2	748.4	61.28
73.2	1.47329	1.3785	1033.2	749.5	61.40
73.3	1.47354	1.3792	1035.1	750.5	61.52
73.4	1.47379	1.3798	1037.1	751.6	61.63
73.5	1.47404	1.3805	1039.0	752.6	61.75
73.6	1.47429	1.3812	1040.9	753.6	61.86
73.7	1.47454	1.3818	1042.8	754.7	61.97
73.8	1.47479	1.3825	1044.8	755.7	62.09
73.9	1.47504	1.3832	1046.8	756.8	62.21
74.0	1.47534	1.3838	1048.6	757.8	62.32
74.1	1.47554	1.3845	1050.7	758.9	62.44
74.2	1.47579	1.3852	1052.6	759.9	62.56
74.3	1.47604	1.3858	1054.6	761.0	62.67
74.4	1.47629	1.3865	1056.5	762.0	62.79
74.5	1.47654	1.3871	1058.5	763.1	62.91
74.6	1.47679	1.3878	1060.4	764.1	63.02
74.7	1.47704	1.3885	1062.3	765.1	63.13
74.8	1.47730	1.3892	1064.4	766.2	63.26
74.9	1.47755	1.3898	1066.3	767.2	63.37
75.0	1.47785	1.3905	1068.3	768.3	63.49

Total dry matter (gravimétrie) (Type-I)

OIV-MA-AS2-03A Total dry matter

Type I method

Definition

The total dry extract or the total dry matter includes all matter that is non‑volatile under specified physical conditions. These physical conditions must be such that the matter forming the extract undergoes as little alteration as possible while the test is being carried out.

The sugar‑free extract is the difference between the total dry extract and the total sugars. The reduced extract is the difference between the total dry extract and the total sugars in excess of 1 g/L, potassium sulfate in excess of 1 g/L, any mannitol present and any other chemical substances which may have been added to the wine.

The residual extract is the sugar‑free extract less the fixed acidity expressed as tartaric acid.

Principle

The weight of residue obtained when a sample of wine, previously absorbed onto filter paper, is dried in a current of air, at a pressure of 20 ‑ 25 mm Hg at 70°C.

Method

3.1. Apparatus

3.1.1. Oven:

Cylindrical basin (internal diameter: 27 cm, height: 6 cm) made of aluminum with an aluminum lid, heated to 70°C and regulated to 1°C.

A tube (internal diameter: 25 mm) connecting the oven to a vacuum pump providing a flow rate of 50 L/h. The air, previously dried by bubbling through concentrated sulfuric acid, is circulated in the oven by a fan in order to achieve quick homogenous reheating. The rate of airflow is regulated by a tap and is to be 30‑40 L per hour and the pressure in the oven is 25 mm of mercury.

The oven can then be used providing it is calibrated as in 3.1.3.

3.1.2. Dishes:

Stainless steel dishes (60 mm internal diameter, 25 mm in height) provided with fitting lids. Each dish contains 4‑4.5 g of filter paper, cut into fluted strips 22 mm in length.

The filter paper is first washed with hydrochloric acid, 2 g/L, for 8 h, rinsed five times with water and then dried in air.

3.1.3. Calibration of apparatus and method

a) Checking the seal of the dish lids. A dish, containing dried filter paper, with the lid on, after first being cooled in a dessicator containing sulfuric acid, should not gain more than 1 mg/h when left in the laboratory.

b) Checking the degree of drying. A pure solution of sucrose, 100 g/L, should give a dry extract of 100 g 1 g/L.

c) A pure solution of lactic acid, 10 g/L, should give a dry extract of at least 9.5 g/L.

If necessary, the drying time in the oven can be increased or decreased by changing the rate of airflow to the oven or by changing the pressure in order that these conditions should be met.

Note: The lactic acid solution can be prepared as follows: 10 mL of lactic acid is diluted to approximately 100 mL with water. This solution is placed in a dish and heated on a boiling water bath for 4 h, distilled water is added if the volume decreases to less than 50 mL (approx). Make up the solution to 1 liter and titrate 10 mL of this solution with alkali, 0.1 M. Adjust the lactic acid solution to 10 g/L.

3.2. Procedure

3.2.1. Weighing the dish

Place the dish containing filter paper in the oven for 1 h. Stop the vacuum pump and immediately place the lid on the dish on opening the oven. Cool in a dessicator and weigh to the nearest 0.1 mg: the mass of the dish and lid is po g.

3.2.2. Weighing the sample

Place 10 mL of must or wine into the weigh dish. Allow the sample to be completely absorbed onto the filter paper. Place the dish in the oven for 2 h (or for the time used in the calibration of the standard in 3.1.3). Weigh the dish following the procedure 3.2.1 beginning "Stop the vacuum ..." The mass is p g.

Note: The sample weight should be taken when analyzing very sweet wines or musts.

3.3. Calculation

The total dry extract is given by:

For very sweet wines or musts the total dry extract is given by:

(P = mass of sample in grams

= density of wine or must in g/mL.

3.4. Expression of results

The total dry extract is expressed in g/L to one decimal place.

Note:

Calculate total dry extract by separately taking into account quantities of glucose and fructose (reducing sugars) and the quantity of saccharose, as follows:

Sugar-free extract = Total dry extract – reducing sugars (glucose + fructose) – saccharose

In the case that the method of analysis allows for sugar inversion, use the following formula for the calculation:

Sugar-free extract = Total dry extract – reducing sugars (glucose + fructose) - [(Sugars after inversion – Sugars before inversion) x 0,95]

Inversion refers to the process that leads to the conversion of a stereoisomer into compounds with reverse stereoisomerism. In particular, the process based on splitting sucrose into fructose and glucose, carried out by keeping acidified solutions containing sugars (100 ml solution containing sugars + 5 ml concentrated hydrochloric acid) for at least 15 min at 50°C or above in a water‑bath (the water‑bath is maintained at 60°C until the temperature of the solution reaches 50°C), is called sugar inversion. The final solution is laevo-rotatory due to the presence of fructose, while the initial solution is dextro-rotatory due to the presence of sucrose.

Table I: For the calculation of the total dry extract content (g/L)

	3^rddecimal place
Density to 2 decimal places	3^rddecimal place
Density to 2 decimal places	0	1	2	3	4	5	6	7	8	9
	Extract g/L
1.00	0	2.6	5.1	7.7	10.3	12.9	15.4	18.0	20.6	23.2
1.01	25.8	28.4	31.0	33.6	36.2	38.8	41.3	43.9	46.5	49.1
1.02	51.7	54.3	56.9	59.5	62.1	64.7	67.3	69.9	72.5	75.1
1.03	77.7	80.3	82.9	85.5	88.1	90.7	93.3	95.9	98.5	101.1
1.04	103.7	106.3	109.0	111.6	114.2	116.8	119.4	122.0	124.6	127.2
1.05	129.8	132.4	135.0	137.6	140.3	142.9	145.5	148.1	150.7	153.3
1.06	155.9	158.6	161.2	163.8	166.4	169.0	171.6	174.3	176.9	179.5
1.07	182.1	184.8	.187.4	190.0	192.6	195.2	197.8	200.5	203.1	205.8
1.08	208.4	211.0	213.6	216.2	218.9	221.5	224.1	226.8	229.4	232.0
1.09	234.7	237.3	239.9	242.5	245.2	247.8	250.4	253.1	255.7	258.4
1.10	261.0	263.6	266.3	268.9	271.5	274.2	276.8	279.5	282.1	284.8
1.11	287.4	290.0	292.7	295.3	298.0	300.6	303.3	305.9	308.6	311.2
1.12	313.9	316.5	319.2	321.8	324.5	327.1	329.8	332.4	335.1	337.8
1.13	340.4	343.0	345.7	348.3	351.0	353.7	356.3	359.0	361.6	364.3
1.14	366.9	369.6	372.3	375.0	377.6	380.3	382.9	385.6	388.3	390.9
1.15	393.6	396.2	398.9	401.6	404.3	406.9	409.6	412.3	415.0	417.6
1.16	420.3	423.0	425.7	428.3	431.0	433.7	436.4	439.0	441.7	444.4
1.17	447.1	449.8	452.4	455.2	457.8	460.5	463.2	465.9	468.6	471.3
1.18	473.9	476.6	479.3	482.0	484.7	487.4	490.1	492.8	495.5	498.2
1.19	500.9	503.5	506.2	508.9	511.6	514.3	517.0	519.7	522.4	525.1
1.20	527.8	-	-	-	-	-	-	-	-	-

Interpolation table

4^th decimal place	Extract g/L	4^th decimal place	Extract g/L	4^th decimal place	Extract g/L
1	0.3	4	1.0	7	1.8
2	0.5	5	1.3	8	2.1
3	0.8	6	1.6	9	2.3

Bibliography

PIEN J., MEINRATH H., Ann. Fals. Fraudes, 1938, 30, 282.
DUPAIGNE P., Bull. Inst. Jus Fruits, 1947, No 4.
TAVERNIER J., JACQUIN P., Ind. Agric. Alim., 1947, 64, 379.
JAULMES P., HAMELLE Mlle G., Bull. O.I.V., 1954, 27, 276.
JAULMES P., HAMELLE Mlle G., Mise au point de chimie analytique pure et appliquée, et d'analyse bromatologique, 1956, par J.A. GAUTIER, Paris, 4e série.
JAULMES P., HAMELLE Mlle G., Trav. Soc. Pharm. Montpellier, 1963, 243.
HAMELLE Mlle G., Extrait sec des vins et des moûts de raisin, 1965, Thèse Doct. Pharm. Montpellier.

Total dry matter (densimétrie) (Type-IV)

OIV-MA-AS2-03B Total dry matter

Type IV method

Definition

The sugar free extract is the difference between the total dry extract and the total sugars. The reduced extract is the difference between the total dry extract and the total sugars in excess of 1 g/L, potassium sulfate in excess of 1 g/L, any mannitol present and any other chemical substances which may have been added to the wine.

The residual extract is the sugar free extract less the fixed acidity expressed as tartaric acid.

Principle

The total dry extract is calculated indirectly from the specific gravity of the must and, for wine, from the specific gravity of the alcohol‑free wine.

This dry extract is expressed in terms of the quantity of sucrose which, when dissolved in water and made up to a volume of one liter, gives a solution of the same gravity as the must or the alcohol‑free wine.

Method

3.1. Procedure

Determine the specific gravity of a must or wine.

In the case of wine, calculate the specific gravity of the "alcohol free wine" using the following formula:

where:

= specific gravity of the wine at 20°C (corrected for volatile acidity ^[(1)])
= specific gravity at 20°C of a water‑alcohol mixture of the same alcoholic strength as the wine obtained using the formula:

where :

= density of the wine at 20°C (corrected for volatile acidity ^[(1)])
= density at 20°C of the water alcohol mixture of the same alcoholic strength as the wine obtained from Table 1 of chapter Alcoholic strength by volume for a temperature of 20°C.

3.2. Calculation

Use the value for specific gravity of the alcohol free wine to obtain the total dry extract (g/L) from table I

3.3. Expression of results

The total dry extract is reported in g/L to one decimal place.

Note:

Calculate total dry extract by separately taking into account quantities of glucose and fructose (reducing sugars) and the quantity of saccharose, as follows:

Sugar-free extract = Total dry extract – reducing sugars (glucose + fructose) – saccharose

In the case that the method of analysis allows for sugar inversion, use the following formula for the calculation:

Sugar-free extract = Total dry extract – reducing sugars (glucose + fructose) - [(Sugars after inversion – Sugars before inversion) x 0,95]

TABLE I

For the calculation of the total dry extract content (g/L)

	3^rddecimal place
Density to 2 decimal places	3^rddecimal place
Density to 2 decimal places	0	1	2	3	4	5	6	7	8	9
	Extract g/L
1.00	0	2.6	5.1	7.7	10.3	12.9	15.4	18.0	20.6	23.2
1.01	25.8	28.4	31.0	33.6	36.2	38.8	41.3	43.9	46.5	49.1
1.02	51.7	54.3	56.9	59.5	62.1	64.7	67.3	69.9	72.5	75.1
1.03	77.7	80.3	82.9	85.5	88.1	90.7	93.3	95.9	98.5	101.1
1.04	103.7	106.3	109.0	111.6	114.2	116.8	119.4	122.0	124.6	127.2
1.05	129.8	132.4	135.0	137.6	140.3	142.9	145.5	148.1	150.7	153.3
1.06	155.9	158.6	161.2	163.8	166.4	169.0	171.6	174.3	176.9	179.5
1.07	182.1	184.8	.187.4	190.0	192.6	195.2	197.8	200.5	203.1	205.8
1.08	208.4	211.0	213.6	216.2	218.9	221.5	224.1	226.8	229.4	232.0
1.09	234.7	237.3	239.9	242.5	245.2	247.8	250.4	253.1	255.7	258.4
1.10	261.0	263.6	266.3	268.9	271.5	274.2	276.8	279.5	282.1	284.8
1.11	287.4	290.0	292.7	295.3	298.0	300.6	303.3	305.9	308.6	311.2
1.12	313.9	316.5	319.2	321.8	324.5	327.1	329.8	332.4	335.1	337.8
1.13	340.4	343.0	345.7	348.3	351.0	353.7	356.3	359.0	361.6	364.3
1.14	366.9	369.6	372.3	375.0	377.6	380.3	382.9	385.6	388.3	390.9
1.15	393.6	396.2	398.9	401.6	404.3	406.9	409.6	412.3	415.0	417.6
1.16	420.3	423.0	425.7	428.3	431.0	433.7	436.4	439.0	441.7	444.4
1.17	447.1	449.8	452.4	455.2	457.8	460.5	463.2	465.9	468.6	471.3
1.18	473.9	476.6	479.3	482.0	484.7	487.4	490.1	492.8	495.5	498.2
1.19	500.9	503.5	506.2	508.9	511.6	514.3	517.0	519.7	522.4	525.1
1.20	527.8	-	-	-	-	-	-	-	-	-

Interpolation table

4^th decimal place	Extract g/L	4^th decimal place	Extract g/L	4^th decimal place	Extract g/L
1	0.3	4	1.0	7	1.8
2	0.5	5	1.3	8	2.1
3	0.8	6	1.6	9	2.3

Bibliography

TABLE DE PLATO, d'après Allgemeine Verwaltungsvorschrift für die Untersuchung von Wein und ähnlichen alkoholischen Erzeugnissen sowie von Fruchtsäften, vom April 1960, Bundesanzeiger Nr. 86 vom 5. Mai 1960. Une table très voisine se trouve dans Official and Tentative Methods of Analysis of the Association of Official Agricultural Chemists, Ed. A.O.A.C., Washington 1945, 815.

^[(1)]⁽¹ ⁾ NOTE: Before carrying out this calculation, the specific gravity (or the density) of the wine measured as specified above should be corrected for the effect of the volatile acidity using the formula:

where a is the volatile acidity expressed in milli-equivalents per liter.

** The coefficient 1.0018 approximates to 1 when rv is below 1.05 which is often the case.

^[(1)]

Ash (Type-I)

OIV-MA-AS2-04 Ash

Type I method

Definition

The ash content is defined to be all those products remaining after igniting the residue left after the evaporation of the wine. The ignition is carried out in such a way that all the cations (excluding the ammonium cation) are converted into carbonates or other anhydrous inorganic salts.

Principle

The wine extract is ignited at a temperature between 500 and 550°C until complete combustion (oxidation) of organic material has been achieved.

Apparatus

3.1. boiling water‑bath at 100C;

3.2. balance sensitive to 0.1 mg;

3.3. hot‑plate or infra‑red evaporator;

3.4. temperature‑controlled electric muffle furnace;

3.5. dessicator;

3.6. flat‑bottomed platinum dish 70 mm in diameter and 25 mm in height.

Procedure

Pipette 20 mL of wine into the previously tared platinum dish (original weight ρo g). Evaporate on the boiling water-bath, and heat the residue on the hot‑plate at 200°C or under the infra‑red evaporator until carbonization begins. When no more fumes are produced, place the dish in the electric muffle furnace maintained at 525 25°C. After 15 min or carbonization, remove the dish from the furnace, add 5 mL of distilled water, evaporate on the water‑bath or under the infra‑red evaporator, and again heat the residue to 525°C for 10 min.

If combustion (oxidation) of the carbonized particles is not complete, the following operations are repeated: washing the carbonized particles, evaporation of water, and ignition. For wines with a high sugar content, it is advantageous to add a few drops of pure vegetable oil to the extract before the first ashing to prevent excessive foaming. After cooling in the desiccator, the dish is weighed (ρ1 g).

The weight of the ash in the sample (20 mL) is then calculated as p = (ρ₁ — ρ_O) g.

Expression of results

The weight P of the ash in grams per liter is given to two decimal places by the expression:

P = 50 p.

Alkalinity of Ash (Type-IV)

OIV-MA-AS2-05 Alkalinity of ash

Type IV method

Definition

The alkalinity of the ash is defined as the sum of cations, other than the ammonium ion, combined with the organic acids in the wine.

Principle

The ash is dissolved in a known (excess) amount of a hot standardized acid solution; the excess is determined by titration using methyl orange as an indicator.

Reagents and apparatus

3.1. Sulfuric acid solution, 0.05 M

3.2. Sodium hydroxide solution, 0.1 M NaOH

3.3. Methyl orange, 0.1% solution in distilled water

3.4. Boiling water‑bath

Procedure

Add 10 mL 0.05 M sulfuric acid solution (3.1) to the ash from 20 mL of wine contained in the platinum dish. Place the dish on the boiling water‑bath for about 15 min, breaking up and agitating the residue with a glass rod to speed up the dissolution. Add two drops of methyl orange solution and titrate the excess sulfuric acid against 0.1 M sodium hydroxide (3.2) until the color of the indicator changes to yellow.

Expression of results

5.1. Method of calculation

The alkalinity of ash, expressed in milliequivalents per liter to one decimal place, is given by:

A=5 (10-n)

where n mL is the volume of sodium hydroxide, 0.1 M, used.

5.2. Alternative expression

The alkalinity of ash, expressed in grams per liter of potassium carbonate, to two decimal places, is given by:

A=0.345 (10-n)

Bibliography

JAULMES P., Analyse des vins, Librairie Poulain, Montpellier, éd., 1951, 107.

Oxidation-reduction potential (Type-IV)

OIV-MA-AS2-06 Measurement of the oxidation-reduction potential in wines

Type IV method

Purpose and scope of application:

The oxidation-reduction potential (EH) is a measure of the oxidation or reduction state of a medium. In the field of enology, oxygen and the oxidation-reduction potential are two important factors in the pre-fermentation processing of the grape harvest, the winemaking process, growing, and wine storage.

Proposals are hereby submitted for equipment designed to measure the Oxidation-reduction Potential in Wines and a working method for taking measurements under normal conditions. This method has not undergone any joint analysis, given the highly variable nature of the oxidation-reduction state of a particular wine, a situation which makes this step in the validation process difficult to implement. As a result, this is a class 4 method ^[1] intended basically for production.

Underlying principle

The oxidation-reduction potential of a medium is defined as the difference in potential between a corrosion-proof electrode immersed in this medium and a standard hydrogen electrode linked to the medium. Indeed, only the difference in oxidation-reductions potentials of two linked systems can be measured. Consequently, the oxidation-reduction potential of the hydrogen electrode is considered to be zero, and all oxidation-reduction potentials are compared to it. The oxidation-reduction potential is a measurement value permitting expression of the instantaneous physico-chemical state of a solution. Only potentiometric volumetric analysis of the total oxidation-reduction pairs and an estimate of the oxidizing agent/reducing agent ratio can yield a true quantitative measurement. Oxidation-reduction potential is measured using combined electrodes, whether in wine or in another solution. This system usually involves the use of a platinum electrode (measuring electrode) and a silver or mercurous chloride electrode (reference electrode).

Equipment

Although several types of electrodes exist, it is recommended that an electrode adapted for measuring the EH in wine be used. It is recommended that use be made of a double-jacket combined electrode linked to a reference electrode (see figure). This system incorporates a measuring electrode, and a double-jacket reference electrode, both of which are linked to an ion meter. The inner jacket of the reference electrode is filled with a solution of 17.1% ; trace amounts of AgCl; trace amounts of Triton X-100; 5% KCL; 77.9% de-ionized water; and for the measuring electrode, the solution is made up of <1% AgCL; 29.8% KCL; and 70% de-ionized water.

Modified Combined Electrode


Oxidant	Reduced	Reductant	Oxidized

Cleaning and calibration of the electrodes

4.1. Calibration

The electrodes are calibrated using solutions with known, constant oxidation-reduction potentials. An equimolar solution (10 mM/l) of ferricyanide and potassium ferrous cyanide is used. Its composition is: 0.329g of ; 0.422g of ; 0.149g of KCl and up to 1000ml of water. At 20 °C this solution has an oxidation-reduction potential of 406 mV (5 mV), but this potential changes over time, thus requiring that the solution not be stored for more than two weeks in the dark.

4.2. Cleaning the Platinum in the Electrode

The electrode platinum should be cleaned by immersing it in a solution of 30% hydrogen peroxide by volume for one hour, then washing it with water. Complete cleaning in water is required after each series of measurement. The system is normally cleaned after each week of use.

Working method

5.1. Filling the Inner Jacket

The composition of the double jacket varies depending on the type of medium for which the EH is being measured (Table below).

Table

Composition of the Filler Solution in the Double Jacket of the Electrode as a Function of the Medium Measured

Medium to be measured	Solution Composition of the jacket
1 Dry wines	Ethanol 12% by vol., 5g tartaric acid, NaOH N up to pH 3.5, distilled water up to 1000 ml
2 Sweet wines	Solution 1 plus 20 g/l sucrose
3 Special sweet wines	Solution 2 plus 100 mg/l of SO₂
4 Brandies	Ethanol 50% by vol., acetic acid up to pH 5, distilled water up to 1000 ml.

5.2. Balancing the Electrode with the Medium to Be Measured

Before taking any measurements, the electrodes must be calibrated in Michaelis solution, then stabilized for 15 minutes in a wine, if the measurement s are to be taken in wines. Next, for measurements taken on site, measurements are read after the electrodes have been immersed in the medium for 5 minutes. For laboratory measurements, the stability index is the EH(mV) / T (minutes) ratio; when this latter is 0.2, the potential can be read.

5.3. Measurements Under Practical Conditions

Measurements are systematically taken on site without any handling that could change the oxidation-reduction potential values. When taking measurements in storehouses, casks, vats, etc. care should be taken to record temperature, pH and dissolved oxygen content (method under preparation) at the same time as the EH measurement is taken, as these measurements will subsequently be used to interpret results. For wines in bottles, the measurement is taken in the wine after letting it sit

in a room whose temperature is 20 °C, immediately after the container is opened, under a constant flow of nitrogen, and after immersing the entire electrode unit in the bottle.

5.4. Expression of Results

Findings are recorded in mV as compared with the standard hydrogen electrode.

^[1] In conformity with the classification detailed in the Codex Alimentarius.

Chromatic Characteristics (Type-IV)

OIV-MA-AS2-07B Chromatic characteristics

Type IV method

Definitions

The "chromatic characteristics" of a wine are its luminosity and chromaticity. Luminosity depends on transmittance and varies inversely with the intensity of color of the wine. Chromaticity depends on dominant wavelength (distinguishing the shade) and purity.

Conventionally, and for the sake of convenience, the chromatic characteristics of red and rosé wines are described by the intensity of color and shade, in keeping with the procedure adopted as the working method.

Principle of the methods

(applicable to red and rosé wines)

A spectrophotometric method whereby chromatic characteristics are expressed conventionally, as given below:

The intensity of color is given by the sum of absorbencies (or optical densities) using a 1 cm optical path and radiations of wavelengths 420, 520 and 620 nm.
The shade is expressed as the ratio of absorbance at 420 nm to absorbance at 520 nm.

Method

3.1. Apparatus

3.1.1. Spectrophotometer enabling measurements to be made between 300 and 700 nm.

3.1.2. Glass cells (matched pairs) with optical path b equal to 0.1, 0.2, 0.5, 1 and 2 cm.

3.2. Preparation of the sample

If the wine is cloudy, clarify it by centrifugation; young or sparkling wines must have the bulk of their carbon dioxide removed by agitation under vacuum.

3.3. Method

The optical path b of the glass cell used must be chosen so that the measured absorbance A, falls between 0.3 and 0.7.

Take the spectrophotometric measurements using distilled water as the reference liquid, in a cell of the same optical path b, in order to set the zero on the absorbance scale of the apparatus at the wavelengths of 420, 520 and 620 nm.

Using the appropriate optical path b, read off the absorbencies at each of these three wavelengths for the wine.

3.4. Calculations

Calculate the absorbencies for a 1 cm optical path for the three wavelengths by dividing the absorbencies found (, and ) by b, in cm.

3.5. Expression of Results

The color intensity I is conventionally given by:

and is expressed to three decimal places.

The shade N is conventionally given by:

and is expressed to three decimal places.

Table 1

Converting absorbance into transmittance (T%)

Method: find the first decimal figure of the absorbance value in the left‑hand column (0-9) and the second decimal figure in the top row (0-9).

Take the figure at the intersection of column and row: to find the transmittance, divide the figure by 10 if absorbance is less than 1, by 100 if between 1 and 2 and by 1000 if between 2 and 3.

Note: The figure in the top right hand corner of each box enables the third decimal figure of the absorbance to be determined by interpolation.

	0	1	2	3	4	5	6	7	8	9
	23	22	22	21	21	20	20	19	19	19
0	1000	977	955	933	912	891	871	851	932	813
	18	18	17	17	16	16	16	15	15	15
1	794	776	759	741	724	708	692	676	661	646
	14	14	14	14	13	13	13	12	12	12
2	631	617	603	589	575	562	549	537	525	513
	11	11	11	11	10	9	9	10	10	9
3	501	490	479	468	457	447	436	427	417	407
	9	9	9	8	8	8	8		7	8
4	398	389	380	371	363	355	347	339	331	324
	7		7	7	6	7	6	6	6	6
5	316	309 71	302	295	288	282	275	269	263	257
	6	5	6	5	5	5	5	5	5	5
6	251	245	240	234	229	224	219	214	209	204
	4	5	4	4	4		4	4	4	4
7	199	195	190	186	182	178	174	170	166	162
	3	4	3	4	4	3	3	3	3	3
8	158	155	151	148	144	141	138	135	132	129
	3	3	3	2	3	2	3	2	3	2
9	126	123	120	117	115	112	110	107	105	102

Example:

Absorbance	0.47	1.47	2.47	3.47
T%	33.9%	3.4%	0.3%	0%

Transmittance (T%) is expressed to the nearest 0.1%.

Figure 1: Chromaticity diagram, showing the locus of all colors of the spectrum

Figure 2: Chromaticity diagram for pure red wines and brick red wines

Une image contenant texte, bâtiment, grille

Description générée automatiquement

Figure 3: Chromaticity diagram for pure red wines and brick red wine

Figure 4:Chromaticity diagram for pure red wines and purple wines

Figure 5:Chromaticity diagram for pure red wines and purple red wines

Figure 6: Chromaticity diagram for brick red wines and purple red wines

Bibliography:

BOUTARIC A., FERRE L., ROY M., Ann. Fals. Fraudes, 1937, 30, 196.
SUDRAUD P., Ann. Technol. Agric., 1958, no 2, 203.
MARECA CORTES J., Atti Acc. Vite Vino, 1964, 16.
GLORIES Y., Conn. vigne et Vin, 1984, 18, no 3, 195.

Wine turbidity (Type-IV)

OIV-MA-AS2-08 Wine turbidity (Determination by Nephelometric Analysis)

Type IV method

Warning

Measurements of turbidity are largely dependent on the design of the equipment used. Therefore, comparative measurements from one instrument to another are not possible unless the same measuring principle is used.

The primary known sources of errors, which are linked to the type of turbidimeter employed, are:

effect of stray light,
effect of product color, especially in cases with low cloudiness values,
electronic shifting due to aging electronic components,
type of light source, photo detector and the dimensions and type of measurement the cell.

The present method uses a nephelometer incorporating a double beam with optical compensation design.

This category of instrument makes it possible to compensate for: electronic shift, fluctuations of mains voltage, and, in part, wine color. Furthermore, calibration is highly stable.

It should be noted that this method does not lend itself to a collation of data from various sources, given the impossibility of conducting an analysis in collaboration with others.

Purpose

The purpose of this document is to describe an optical method capable of measuring the turbidity (or diffusion) index of wine.

Scope of application

This method is used in the absence of instruments allowing a completely faithful duplication of measurements from one device to another, as well as full compensation for wine color. Therefore, findings are given for informational purposes only, and must be considered with caution.

Above all, this technique is intended for use in production, where it is the most objective criterion of the measurement of clarity.

This method, which cannot be validated accordingly to internationally recognized criteria, will be classified as class 4¹.

General principle

Turbidity is an optical effect.

The diffusion index is an intrinsic property of liquids that makes it possible to describe their optical appearance. This optical effect is produced by the presence of extremely fine particles scattered in a liquid dispersion medium. The refraction index of these particles differs from that of the dispersion medium.

If a light is shown through a quantity of optically clean water placed in a container of known volume and the luminous flux diffused with respect to an incident beam is measured, the recorded value of this diffused flux will allow description of the molecular diffusion in the water.

If the value obtained for the water thus analyzed is greater than that of the molecular diffusion, which remains constant for a given wavelength, the same incident flux at the same angle measurement, in a tank of the same shape and at a given temperature, the difference can be attributed to the light diffused by solid, liquid or gaseous particles suspended in the water.

The measurement (taken as described) of the diffused luminous flux constitutes a nephelometric measurement.

Definitions

5.1. Turbidity

Reduction of the transparency of a liquid due to the presence of undissolved substances.

5.2. Units of Measurement of the Turbidity Index

The unit of turbidity used is: NTU - Nephelometric Turbidity Unit, which is the value corresponding to the measurement of the light diffused by a standard formazine suspension prepared as described under point 6.2.2, at a 90° angle to the direction of the incident beam.

Preparing the reference Formazine suspension ([1])

6.1. Reagents

All reagents must be of recognized analytical quality.

They must be stored in glass flasks.

6.1.1. Water for Preparing Control Solutions.

Soak a filter membrane with a pore size of 0.1 μm (like those used in bacteriology) for one hour in 100 ml of distilled water. Filter 250 ml distilled water twice through this membrane, and retain this water for preparation of standard solutions.

6.1.2. Formazine () Solutions

The compound known as formazine, whose formula is , is not commercially available. It can be produced using the following solutions:

Solution A: Dissolve 10.0 g hexamethylene-tetramine in distilled water prepared according to the instructions in 6.1.1. Then fill to a volume of 100 ml using distilled water.
Solution B: Dissolve 1.0 g of hydrazinium sulfate, , in distilled water prepared according to the instruction in 6.1.1. Then fill to a volume of 100 ml using distilled water prepared according to 6.1.1.

Warning: Hydrazinium sulfate is poisonous and may be carcinogenic.

6.2. Working Method

Mix 5 ml of Solution A and 5 ml of Solution B. Dilute the solution to a volume of 100 ml with water after 24 hours at 25 °C 3 °C (6.1.1).

The turbidity of this standard solution is 400 NTU.

This standard suspension will keep for approximately 4 weeks at room temperature in the dark.

By diluting to 1/400 with recently prepared distilled water, a turbidity of 1 NTU will be obtained.

This solution remains stable for one week only.

N.B.: Standard formazine solutions have been compared to standard polymer-based solutions. The differences observed may be considered negligible. Nonetheless, polymer-based standard solutions have the following drawbacks: they are very expensive and they have a limited useful life. They must be handled with care to avoid breaking the polymer particles, as breakage would alter the turbidity value. Polymer use is suggested as an alternative to formazine.

Optical Measurement Principle

Une image contenant texte, câble

Description générée automatiquement

Measurement principle:

L1= Incident light beam
L2= Beam after passing through sample
P= Sample
St= diffused light
G/G1 = Limiting rays from the diffused light beam used for measurement

The diffused light should be observed at an angle of 90° to the direction of propagation of the incident beam.

Instrumentation
1. Optical principle of the dual-beam and optical compensation nephelometer

A light source (1) powered by the electricity network projects a beam of light onto an oscillating mirror (2) which alternately reflects a measuring beam (3) and a comparison beam (4) at a rate of approximately 600 times per second.

The measuring beam (3) propagates through the fluid to be measured (5) while the comparison beam (4) propagates through an optically stable turbidity-comparison standard fluid (6).

The light diffused by the particles producing turbidity in the fluid (5) and the light diffused by the standard comparison solution (6) are alternately received by a photoelectric cell (7).

Accordingly, this cell receives a measuring beam (3) and a comparison (4) having the same frequency, but different whose luminous intensities.

The photoelectric cell (7) transforms these unequal luminous intensities into electric current which are in turn amplified (8) and fed to a synchronous motor (9) functioning as a servo-motor.

This motor uses a mechanical measuring diaphragm (10) to vary the intensity of the control beam, until the two beams strike the photoelectric cell with equal luminous intensity.

This equilibrium state allows the solid particle content of the fluid to be determined.

The absolute value of the measurement depends on the dimensions of the standard comparison beam and on the position of the diaphragm.

8.2. Characteristics

Note: In order to take these measurements, regardless of the color of the wine, the nephelometer must be equipped with an additional interferential filter allowing measurement at a wavelength of 620 nm. However, the interferential filter is not needed if the light source is an infrared one.

8.2.1. The width of the spectral band of the incident radiation should be less than or equal to 60 nm.

8.2.2. There should be no divergence in the parallelism of the incident radiation, and convergence must not exceed 1.5°.

8.2.3. The angle of measurement between the optical axis of the incident radiation and that of the diffused radiation should be 90° 2.5°.

8.2.4. The apparatus must not cause error due to stray light greater than:

NTU of random light error

within a range of:

0 to 0.1 NTU.

Operating method for measurement

9.1. Checking the Apparatus

Before taking any measurement or series of measurements, check to ensure the proper electrical and mechanical operation of the apparatus in accordance with the recommendations of the manufacturer.

9.2. Check Measurement Scale Adjustment

Before taking any measurement or series of measurements, use a previously calibrated instrument to check its measurement scale adjustment consistent with the principle underlying its design.

9.3. Cleaning the Measuring Unit

With the greatest care, clean the measuring tank before all analyses. Take all necessary precautions to avoid getting dust in the apparatus and especially in the measuring unit, before and during determination of the turbidity index.

9.4. Taking Measurements

The operating temperature should be between 15° and 25 °C (Take the temperature of the wine to be measured into consideration to ensure proper comparison). Prior to taking the measurement, carefully homogenize the product and, without making any abrupt movement that could create an emulsion, the flask holding the product to be analyze.

Carefully wash the measuring tank twice with a small amount of the product to be analyzed.

Carefully pour the product to be analyzed into the measuring tank, taking care to avoid any turbulence in the flow of the liquid, since this would lead to the formation of air bubbles. Carry out the test measurements.

Wait one minute if the index value is stable.

Record the resulting turbidity index.

Expressing the results

The turbidity index of the wine undergoing analysis is recorded and expressed in:

NTU
* if turbidity is less than 1 NTU, round off to 0.01 NTU
* if turbidity is between 1 NTU and 10 NTU, round off to 0.1 NTU
*if turbidity is between 10 NTU and 100 NTU, round off to 1 NTU

Test report

The test should contain the following information:

reference to this method
the results, expressed as indicated in 10
any detail or occurrence that may have affected the findings.

Bibliography

AFNOR, Standard NF EN 27027 (ISO 7027) - April 1994,"Water Quality = Turbidity Analysis"
OIV, Compendium of International Methods for Spirits, Alcohols and the Aromatic Fractions in Beverages – 1994, "Turbidity – Nephelometric Analysis Method"
SIGRIST PHOTOMETER SA, CH 6373 Ennetburgen, "Excerpts from technical instructions for nephelometers"

⁽^[1]⁾Care must be given to the precautions for handling, since Formazine is somewhat toxic.

Folin-Ciocalteu Index (Type-IV)

OIV-MA-AS2-10 Folin Ciocalteu Index

Type IV method

Definition

The Folin-Ciocalteu index is the result obtained by applying the method described below.

Principle

All phenolic compounds contained in wine are oxidized by Folin-Ciocalteu reagent. This reagent is formed from a mixture of phosphotungstic acid,, and phosphomolybdic acid, , which, after oxidation of the phenols, is reduced to a mixture of blue oxides of tungsten, , and molybdenum, . The blue coloration produced has a maximum absorption in the region of 750 nm, and is proportional to the total quantity of phenolic compounds originally present.

Apparatus

Normal laboratory apparatus, in particular:

3.1. 100 mL volumetric flasks.

3.2. Spectrophotometer capable of operating at 750 nm.

Reagents
1. Folin-Ciocalteu reagent

This reagent is available commercially in a form ready for use.

Alternatively it may be prepared as follows: dissolve 100 g of sodium tungstate, , and 25 g of sodium molybdate, , in 700 mL of distilled water. Add 50 mL phosphoric acid 85% (ρ₂₀ = 1.71 g/mL), and 100 mL of concentrated hydrochloric acid (ρ₂₀ = 1.19 g/mL). Bring to the boil and reflux for 10 hours. Then add 150 g of lithium sulfate, , and a few drops of bromine and boil for 15 minutes. Allow to cool and make up to one liter with distilled water.

4.2. Anhydrous sodium carbonate, Na₂CO₃, made up into a 20% (m/v) solution.

Procedure
1. Red wine

Introduce the following into a 100 mL volumetric flask (3.1) strictly in the following order:

1 mL of the wine, previously diluted 1/5,
50 mL of distilled water,
5 mL of Folin-Ciocalteu reagent (4.1),
20 mL of sodium carbonate solution (4.2).

Bring to 100 mL with distilled water.

Mix to dissolve. Leave for 30 minutes for the reaction to stabilize. Determine the absorbance at 750 nm through a path length of 1 cm with respect to a blank prepared with distilled water in place of the wine.

If the absorbance is not in the region of 0.3 appropriate dilution should be made.

5.2. White wine

Carry out the same procedure with 1 mL of undiluted wine.

Expression of results
1. Calculation

The result is expressed in the form of an index obtained by multiplying the absorbance by 100 for red wines diluted 1/5 (or by the corresponding factor for other dilutions) and by 20 for white wines.

6.2. Precision

The difference between the results of two determinations carried out simultaneously or very quickly one after the other by the same analyst must not be greater than 1. Good precision of results is aided by using scrupulously clean apparatus (volumetric flasks and spectrophotometer cells).

Chromatic Characteristics (Type-I)

OIV-MA-AS2-11 Determination of chromatic characteristics according to CIELab

Type I method

Introduction

The colour of a wine is one of the most important visual features available to us, since it provides a considerable amount of highly relevant information.

Colour is a sensation that we perceive visually from the refraction or reflection of light on the surface of objects. Colour is light—as it is strictly related to it—and depending on the type of light (illuminating or luminous stimulus) we see one colour or another. Light is highly variable and so too is colour, to a certain extent.

Wine absorbs a part of the radiations of light that falls and reflects another, which reaches the eyes of the observer, making them experience the sensation of colour. For instance, the sensation of very dark red wines is almost entirely due to the fact that incident radiation is absorbed by the wine.

1.1. Scope

The purpose of this spectrophotometric method is to define the process of measuring and calculating the chromatic characteristics of wines and other beverages derived from trichromatic components: X, Y and Z, according to the Commission Internationale de l’Eclairage (CIE, 1976), by attempting to imitate real observers with regard to their sensations of colour.

1.2. Principle and definitions

The colour of a wine can be described using 3 attributes or specific qualities of visual sensation: tonality, luminosity and chromatism.

Tonality—colour itself—is the most characteristic: red, yellow, green or blue. Luminosity is the attribute of visual sensation according to which a wine appears to be more or less luminous. However, chromatism, or the level of colouring, is related to a higher or lower intensity of colour. The combination of these three concepts enables us to define the multiple shades of colour that wines present.

The chromatic characteristics of a wine are defined by the colorimetric or chromaticity coordinates (Fig. 1): clarity (L^*), red/green colour component (a^*), and blue/yellow colour component (b^*); and by its derived magnitudes: chroma (C^*), tone (H^*) and chromacity [(a^*, b^*) or (C^*, H^*)]. In other words, this CIELab colour or space system is based on a sequential or continuous Cartesian representation of 3 orthogonal axes: L^*, a^* and b^* (Fig. 2 and 3). Coordinate L^*represents clarity (L^*= 0 black and L^*= 100 colourless), a^* green/red colour component (a^*>0 red, a^*<0 green) and b^* blue/yellow colour component (b^*>0 yellow, b^*<0 blue).

1.2.1. Clarity

Its symbol is L^* and it is defined according to the following mathematical function:

Directly related to the visual sensation of luminosity.

1.2.2. Red/green colour component

Its symbol is a^* and it is defined according to the following mathematical function:

(I)

1.2.3. Yellow/blue colour component

Its symbol is b^* and it is defined according to the following mathematical function:

(I)

1.2.4. Chroma

The chroma symbol is C^* and it is defined according to the following mathematical function:

1.2.5. Tone

The tone symbol is H^*, its unit is the sexagesimal degree (º), and it is defined according to the following mathematical function:

1.2.6. Difference of tone between two wines

The symbol is ∆H* and it is defined according to the following mathematical function:

(I) See explanation Annex I

1.2.7. Overall colorimetric difference between two wines

The symbol is ∆E* and it is defined according to the following mathematical functions:

1.3. Reagents and products

Distilled water.

1.4. Apparatus and equipment

Customary laboratory apparatus and, in particular, the following:

1.4.1. Spectrophotometer to carry out transmittance measurements at a wavelength of between 300 and 800 nm, with illuminant D65 and observer placed at 10º. Use apparatus with a resolution equal to or higher than 5 nm and, where possible, with scan.

1.4.2. Computer equipment and suitable programme which, when connected to the spectrophotometer, will facilitate calculating colorimetric coordinates (L^*, a^* and b^*) and their derived magnitudes (C^* and H^*).

1.4.3. Glass cuvettes, available in pairs, optical thickness 1, 2 and 10 mm.

1.4.4. Micropipettes for volumes between 0.020 and 2 ml.

1.5. Sampling and sample preparation

Sample taking must particularly respect all concepts of homogeneity and representativity.

If the wine is dull, it must be clarified by centrifugation. For young or sparkling wines, as much carbon dioxide as possible must be eliminated by vacuum stirring or using a sonicator.

1.6. Procedure

Select the pair of cuvettes for the spectrophotometric reading, ensuring that the upper measurement limit within the linear range of the spectrophotometer is not exceeded. By way of indication, for white and rosé wines it is recommended to use cuvettes with 10 mm of optical thickness, and for red wines, cuvettes with 1 mm optical thickness.

After obtaining and preparing the sample, measure its transmittance from 380 to 780 nm every 5 nm, using distilled water as a reference in a cuvette with the same optical thickness, in order to establish the base line or the white line. Choose illuminant D65 and observer 10º

If the optical thickness of the reading cuvette is under 10 mm, the transmittance must be transformed to 10 mm before calculating: L^*, a^*, b^*, C^* and H^*.

Summary:

Spectral measurements in transmittance from 780 to 380 nm

Interval: 5 nm

Cuvettes: use appropriately according to wine intensity: 1 cm (white and rosé wines) and 0.1 cm (red wines)

Illuminant D65

Observer reference pattern 10º

1.7. Calculations

The spectrophotometer must be connected to a computer programme to facilitate the calculation of the colorimetric coordinates (L^*, a^* and b^*) and their derived magnitudes (C^* and H^*), using the appropriate mathematical algorithms.

In the event of a computer programme not being available, see Annex I on how to proceed.

1.8. Expression of results

The colorimetric coordinates of wine will be expressed according to the recommendations in the following table.

Colorimetric coordinates	Symbol	Unit	Interval	Decimals
Clarity	L^*		0-100 0 black 100 colourless	1
Red/green colour component	a^*		>0 red <0 green	2
Yellow/blue colour component	b^*		>0 yellow <0 blue	2
Chroma	C^*			2
Tone	H^*	º	0-360º	2

1.9. Numerical Example

Figure 4 shows the values of the colorimetric coordinates and the chromaticity diagram of a young red wine for the following values:

X = 12.31; Y = 60.03 and Z = 10.24

L* = 29.2

a* = 55.08

b* = 36.10

C* = 66.00

H* = 33.26º

Accuracy

The above data were obtained from two interlaboratory tests of 8 samples of wine with blind duplicates of progressive chromatic characteristics, in accordance with the recommendations of the harmonized protocol for collaborative studies, with a view to validating the method of analysis.

Colorimetric coordinate L* (clarity, 0-100)

Sample Identification	A	B	C	D	E	F	G	H
Year of interlaboratory test	2004	2002	2004	2004	2004	2004	2002	2004
No. of participating laboratories	18	21	18	18	17	18	23	18
No. of laboratories accepted after aberrant value elimination	14	16	16	16	14	17	21	16
Mean value ()	96.8	98.0	91.6	86.0	77.4	67.0	34.6	17.6
Repeatability standard deviation (s_r)	0.2	0.1	0.2	0.8	0.2	0.9	0.1	0.2
Relative repeatability standard deviation (RSD_r) (%)	0.2	0.1	0.3	1.0	0.3	1.3	0.2	1.2
Repeatability limit (r) (2.8 x s_r)	0.5	0.2	0.7	2.2	0.7	2.5	0.2	0.6
Reproducibility standard deviation (s_R)	0.6	0.1	1.2	2.0	0.8	4.1	1.0	1.0
Relative reproducibility standard deviation (RSD_R) (%)	0.6	0.1	1.3	2.3	1.0	6.1	2.9	5.6
Reproducibility limit (R) (2.8 x s_R)	1.7	0.4	3.3	5.5	2.2	11.5	2.8	2.8

Colorimetric coordinate a* (green/red)

Sample Identification	A	B	C	D	E	F	G	H
Year of interlaboratory	2004	2002	2004	2004	2004	2004	2002	2004
No. of participating laboratories	18	21	18	18	17	18	23	18
No. of laboratories accepted after aberrant value elimination	15	15	14	15	13	16	23	17
Mean value ()	-0.26	-0.86	2.99	11.11	20.51	29.29	52.13	47.55
Repeatability standard deviation (s_r)	0.17	0.01	0.04	0.22	0.25	0.26	0.10	0.53
Relative repeatability standard deviation (RSD_r) (%)	66.3	1.4	1.3	2.0	1.2	0.9	0.2	1.1
Repeatability limit (r) (2.8 x s_r)	0.49	0.03	0.11	0.61	0.71	0.72	0.29	1.49
Reproducibility standard deviation (s_R)	0.30	0.06	0.28	0.52	0.45	0.98	0.88	1.20
Relative reproducibility standard deviation (RSD_R) (%)	116.0	7.5	9.4	4.7	2.2	3.4	1.7	2.5
Reproducibility limit (R) (2.8 x s_R)	0.85	0.18	0.79	1.45	1.27	2.75	2.47	3.37

Colorimetric coordinate b* (blue/yellow)

Sample Identification	A	B	C	D	E	F	G	H
Year of interlaboratory	2004	2002	2004	2004	2004	2004	2002	2004
No. of participating laboratories	17	21	17	17	17	18	23	18
No. of laboratories accepted after aberrant value elimination	15	16	13	14	16	18	23	15
Mean value ()	10.95	9.04	17.75	17.10	19.68	26.51	45.82	30.07
Repeatability standard deviation (s_r)	0.25	0.03	0.08	1.08	0.76	0.65	0.15	0.36
Relative repeatability standard deviation (RSD_r) (%)	2.3	0.4	0.4	6.3	3.8	2.5	0.3	1.2
Repeatability limit (r) (2.8 x s_r)	0.71	0.09	0.21	3.02	2.12	1.83	0.42	1.01
Reproducibility standard deviation (s_R)	0.79	0.19	0.53	1.18	3.34	2.40	1.44	1.56
Relative reproducibility standard deviation (RSD_R) (%)	7.2	2.1	3.0	6.9	16.9	9.1	3.1	5.2
Reproducibility limit (R) (2.8 x s_R)	2.22	0.53	1.47	3.31	9.34	6.72	4.03	4.38

Bibliography

Vocabulaire International de l'Éclairage. Publication CIE 17.4.- Publication I.E.C. 50(845). CEI(1987). Genève. Suisse.
Colorimetry, 2^nd Ed.- Publication CIE 15.2 (1986) Vienna.
Colorimetry, 2^nd Ed.- Publication CIE 15.2 (1986) Vienna.
Kowaliski P. – Vision et mesure de la couleur. Masson ed. Paris 1990
Wiszecki G. And W.S.Stiles, Color Science, Concepts and Methods, Quantitative Data and Formulae, 2^nd Ed. Wiley, New York 1982
Sève R. .- Physique de la couleur. Masson. Paris (1996)
Echávarri J.F., Ayala F. et Negueruela A.I. .-Influence du pas de mesure dans le calcul des coordonnées de couleur du vin. Bulletin de l'OIV 831-832, 370-378 (2000)
I.R.A.N.O.R . Magnitudes Colorimetricas. Norma UNE 72-031-83
Bertrand A.- Mesure de la couleur. F.V. 1014 2311/190196
Fernández, J.I.; Carcelén, J.C.; Martínez, A. III Congreso Nacional De Enologos, 1.997. Caracteristicas cromaticas de vinos rosados y tintos de la cosecha de 1996 en la region de murcia
Cagnaso E..- Metodi Oggettivi per la definizione del colore del vino. Quaderni della Scuoladi Specializzazione in Scienze Viticole ed Enologiche. Universidad di Torino. 1997
Ortega A.P., Garcia M.E., Hidalgo J., Tienda P., Serrano J. – 1995- Identificacion y Normalizacion de los colores del vino. Carta de colores. Atti XXI Congreso Mundial de la Viña y el Vino, Punta del Este. ROU 378-391
Iñiguez M., Rosales A., Ayala R., Puras P., Ortega A.P.- 1995 - La cata de color y los parametros CIELab, caso de los vinos tintos de Rioja. Atti XXI Congreso Mundial de la Viña y el Vino, Punta del Este.ROU 392-411
Billmeyer, F.W. jr. and M. Saltzman: Principles of Color. Technology, 2. Auflage, New York; J. Wiley and Sons, 1981.

Appendix 1

In formal terms, the trichromatic components X, Y, Z of a colour stimulus result from the integration, throughout the visible range of the spectrum, of the functions

obtained by multiplying the relative spectral curve of the colour stimulus by the colorimetric functions of the reference observer. These functions are always obtained by experiment. It is not possible, therefore to calculate the trichromatic components directly by integration. Consequently, the approximate values are determined by replacing these integrals by summations on finished wavelength intervals.

	T ₍λ₎is the measurement of the transmittance of the wine measured at the wavelength λ expressed at 1 cm from the optical thickness.
	₍_₎is the interval between the value of λ at which T ₍λ)is measured
	S ₍λ₎: coefficients that are a function of λ and of the illuminant (Table 1).
	: coefficients that are a function of  and of the observer. (Table 1)

The values of Xn, Yn, and Zn represent the values of the perfect diffuser under an illuminant and a given reference observer. In this case, the illuminant is D65 and the observer is higher than 4 degrees.

= 94.825; = 100; = 107.381

This roughly uniform space is derived from the space CIEYxy, in which the trichromatic components X, Y, Z are defined.

The coordinates L*, a*and b*are calculated based on the values of the trichromatic components X, Y, Z, using the following formulae.

	L* = 116 (Y / Y_n)^1/3  16		where Y/Yn > 0.008856
	L* = 903.3 (Y / Y_n)		where Y / Y_n < ó = 0.008856
	a* = 500 [ f(X / )  f(Y / Y_n) 
	b* = 200 [f(Y / Y_n)  f(Z / Z_n) 
f(X / X_n) = (X / )^1/3		where (X / X_n) > 0.008856
f(X / X_n) = 7.787 (X / X_n) + 16 / 166		where (X / X_n) < ó = 0.008856
f(Y / Y_n) = (Y / Y_n)^1/3		where (Y / Y_n) > 0.008856
f(Y / Y_n) = 7.787 (Y / Y_n) + 16 / 116		where (Y / Y_n) < ó = 0.008856
f(Z / Z_n) = (Z / Z_n)^1/3		where (Z / Z_n) > 0.008856
f(Z / Z_n) = 7.787 (Z / Z_n) + 16 / 116		where (Z / Z_n) < ó = 0.008856

The total colorimetric difference between two colours is given by the CIELAB colour difference

In the CIELAB space it is possible to express not only overall variations in colour, but also in relation to one or more of the parameters L*, a* and b*. This can be used to define new parameters and to relate them to the attributes of the visual sensation.

Clarity, related to luminosity, is directly represented by the value of L*.

Chroma: defines the chromaticness.

The angle of hue: H* = tg^-1(b*/a*) (expressed in degrees); related to hue.

The difference in hue:

For two unspecified colours, C* represents their difference in chroma; L*, their difference in clarity, and E*, their overall variation in colour. We thus have:

Table 1.

	Wavelength (λ) nm.
	380		50.0		0.0002		0.0000		0.0007
	385		52.3		0.0007		0.0001		0.0029
	390		54.6		0.0024		0.0003		0.0105
	395		68.7		0.0072		0.0008		0.0323
	400		82.8		0.0191		0.0020		0.0860
	405		87.1		0.0434		0.0045		0.1971
	410		91.5		0.0847		0.0088		0.3894
	415		92.5		0.1406		0.0145		0.6568
	420		93.4		0.2045		0.0214		0.9725
	425		90.1		0.2647		0.0295		1.2825
	430		86.7		0.3147		0.0387		1.5535
	435		95.8		0.3577		0.0496		1.7985
	440		104.9		0.3837		0.0621		1.9673
	445		110.9		0.3867		0.0747		2.0273
	450		117.0		0.3707		0.0895		1.9948
	455		117.4		0.3430		0.1063		1.9007
	460		117.8		0.3023		0.1282		1.7454
	465		116.3		0.2541		0.1528		1.5549
	470		114.9		0.1956		0.1852		1.3176
	475		115.4		0.1323		0.2199		1.0302
	480		115.9		0.0805		0.2536		0.7721
	485		112.4		0.0411		0.2977		0.5701
	490		108.8		0.0162		0.3391		0.4153
	495		109.1		0.0051		0.3954		0.3024
	500		109.4		0.0038		0.4608		0.2185
	505		108.6		0.0154		0.5314		0.1592
	510		107.8		0.0375		0.6067		0.1120
	515		106.3		0.0714		0.6857		0.0822
	520		104.8		0.1177		0.7618		0.0607
	525		106.2		0.1730		0.8233		0.0431
	530		107.7		0.2365		0.8752		0.0305
	535		106.0		0.3042		0.9238		0.0206
	540		104.4		0.3768		0.9620		0.0137
	545		104.2		0.4516		0.9822		0.0079
	550		104.0		0.5298		0.9918		0.0040
	555		102.0		0.6161		0.9991		0.0011
	560		100.0		0.7052		0.9973		0.0000
	565		98.2		0.7938		0.9824		0.0000
570		96.3		0.8787		0.9556		0.0000
575		96.1		0.9512		0.9152		0.0000
580		95.8		1.0142		0.8689		0.0000
585		92.2		1.0743		0.8256		0.0000
590		88.7		1.1185		0.7774		0.0000
595		89.3		1.1343		0.7204		0.0000
600		90.0		1.1240		0.6583		0.0000
605		89.8		1.0891		0.5939		0.0000
610		89.6		1.0305		0.5280		0.0000
615		88.6		0.9507		0.4618		0.0000
620		87.7		0.8563		0.3981		0.0000
625		85.5		0.7549		0.3396		0.0000
630		83.3		0.6475		0.2835		0.0000
635		83.5		0.5351		0.2283		0.0000
640		83.7		0.4316		0.1798		0.0000
645		81.9		0.3437		0.1402		0.0000
650		80.0		0.2683		0.1076		0.0000
655		80.1		0.2043		0.0812		0.0000
660		80.2		0.1526		0.0603		0.0000
665		81.2		0.1122		0.0441		0.0000
670		82.3		0.0813		0.0318		0.0000
675		80.3		0.0579		0.0226		0.0000
680		78.3		0.0409		0.0159		0.0000
685		74.0		0.0286		0.0111		0.0000
690		69.7		0.0199		0.0077		0.0000
695		70.7		0.0138		0.0054		0.0000
700		71.6		0.0096		0.0037		0.0000
705		73.0		0.0066		0.0026		0.0000
710		74.3		0.0046		0.0018		0.0000
715		68.0		0.0031		0.0012		0.0000
720		61.6		0.0022		0.0008		0.0000
725		65.7		0.0015		0.0006		0.0000
730		69.9		0.0010		0.0004		0.0000
735		72.5		0.0007		0.0003		0.0000
740		75.1		0.0005		0.0002		0.0000
745		69.3		0.0004		0.0001		0.0000
750		63.6		0.0003		0.0001		0.0000
755		55.0		0.0002		0.0001		0.0000
760		46.4		0.0001		0.0000		0.0000
765		56.6		0.0001		0.0000		0.0000
770		66.8		0.0001		0.0000		0.0000
775		65.1		0.0000		0.0000		0.0000
780		63.4		0.0000		0.0000		0.0000

Figure 1. Diagram of colourimetric coordinates according to Commission Internationale de l’Eclairage (CIE, 1976)

Figure 2. CIELab colourspace, based on a sequential or 3 orthogonal axis continual Cartesian representation L*, a* y b*

Figure 3. Sequential diagram and/or continuation of a and b colourimetric coordinates and derived magnitude, such as tone (H*)

Figure 4. Representation of colour of young red wine used as an example in Chapter 1.8 shown in the CIELab three dimensional diagram.

Method for 18O/16O isotope ratio determination of water in wines and must (Type-II)

OIV-MA-AS2-12 Method for isotope ratio determination of water in wines and must

Type II method

Scope

The method describes the determination of the ¹⁸O/¹⁶O isotope ratio of water from wine and must after equilibration with CO₂, using the isotope ratio mass spectrometry (IRMS).

Reference standards

ISO 5725:1994: Accuracy (trueness and precision) of measurement methods and results: Basic method for the determination of repeatability and reproducibility of a standard measurement method.

V-SMOW: Vienna-Standard Mean Ocean Water ( = = 0.0020052)
GISP Greenland Ice Sheet Precipitation
SLAP Standard Light Antarctic Precipitation

Definitions

Isotope ratio of oxygen 18 to oxygen 16 for a given sample

δ¹⁸O_V-SMOW Relative scale for the expression of the isotope ratio of oxygen 18 to oxygen 16 for a given sample. δ¹⁸O_V-SMOWis calculated using the following equation:

using the V-SMOW as standard and as reference point for the relative δ scale.

BCR: Community Bureau of Reference
IAEA: International Atomic Energy Agency (Vienna, Austria)
IRMM: Institute for Reference Materials and Measurements
IRMS: Isotope Ratio Mass Spectrometry
m/z: mass to charge ratio
NIST: National Institute of Standards & Technology
RM: Reference Material

Principle

The technique described thereafter is based on the isotopic equilibration of water in samples of wine or must with a CO₂ standard gas according to the following isotopic exchange reaction:

After equilibration the carbon dioxide in the gaseous phase is used for analysis by means of Isotopic Ratio Mass Spectrometry (IRMS) where the isotopic ratio is determined on the CO₂ resulting from the equilibration.

Reagents and materials

The materials and consumables depend on the method used (see chapter 6). The systems generally used are based on the equilibration of water in wine or must with .

The following reference materials, working standards and consumables can be used:

5.1. Reference materials

Name	issued by	δ¹⁸O versus V-SMOW
V-SMOW, RM 8535	IAEA / NIST	0 ‰
BCR-659	IRMM	-7.18 ‰
GISP, RM 8536	IAEA / NIST	-24.78 ‰
SLAP, RM 8537	IAEA / NIST	-55.5 ‰

5.2. Working Standards

5.2.1. Carbon dioxide as a secondary reference gas for measurement (CAS 00124-38-9).

5.2.2. Carbon dioxide used for equilibration (depending on the instrument this gas could be the same as 5.2.1 or in the case of continuous flow systems cylinders containing gas mixture helium-carbon dioxide can also be used)

Working Standards with calibrated δ¹⁸ values traceable to international reference materials.

5.3. Consumables

Helium for analysis (CAS 07440-59-7)

Apparatus

6.1. Isotope ratio mass spectrometry (IRMS)

The Isotope ratio mass spectrometer (IRMS) enables the determination of the relative contents of ¹⁸O of CO₂ gas naturally occurring with an internal accuracy of 0.05%. Internal accuracy here is defined as the difference between 2 measurements of the same sample of CO₂.

The mass spectrometer used for the determination of the isotopic composition of CO₂ gas is generally equipped with a triple collector to simultaneously measure the following ion currents:

m/z = 44 ()
m/z = 45 ( and )
m/z = 46 (, and )

By measuring the corresponding intensities, the ¹⁸O/¹⁶O isotopic ratio is determined from the ratio of intensities of m/z = 46 and m/z = 44 after corrections for isobaric species ( and ) whose contributions can be calculated from the actual intensity observed for m/z= 45 and the usual isotopic abundances for and in Nature.

The isotope ratio mass spectrometry must either be equipped with:

a double introduction system (dual inlet system) to alternately measure the unknown sample and a reference standard.
or a continuous flow system that transfers quantitatively the CO₂ from the sample vials after equilibration but also the CO₂ standard gas into the mass spectrometer.

6.2. Equipment and Materials

All equipments and materials used must meet stated requirements of the used method / apparatus (as specified by the manufacturer). However, all equipments and materials can be replaced by items with similar performance.

6.2.1. Vials with septa appropriate for the used system

6.2.2. Volumetric pipettes with appropriate tips

6.2.3. Temperature controlled system to carry out the equilibration at constant temperature, typically within 1 °C

6.2.4. Vacuum pump (if needed for the used system)

6.2.5. Autosampler (if needed for the used system)

6.2.6. Syringes for sampling (if needed for the used system)

6.2.7. GC Column to separate CO₂ from other elementary gases (if needed for the used system)

6.2.8. Water removal device (e.g. cryo-trap, selective permeable membranes)

Sampling

Wine and must samples as well as reference materials are used for analysis without any pre-treatment. In the case of the possible fermentation of the sample, benzoic acid (or another anti-fermentation product) should be added or filtered with a with a 0,22 μm pore diameter filter.

Preferably, the reference materials used for calibration and drift-correction should be placed at the beginning and at the end of the sequence and inserted after every ten samples.

Procedure

The descriptions that follow refer to procedures generally used for the determination of the ¹⁸O/¹⁶O isotopic ratios by means of equilibration of water with a CO₂ working standard and the subsequent measurement by IRMS. These procedures can be altered according to changes of equipment and instrumentation provided by the manufacturers as various kind of equilibration devices are available, implying various conditions of operation. Two main technical procedures can be used for introduction of CO₂ into the IRMS either through a dual inlet system or using a continuous flow system. The description of all these technical systems and of the corresponding conditions of operation is not possible. Note: all values given for volumes, temperatures, pressures and time periods are only indicative. Appropriate values must be obtained from specifications provided by the manufacturer and/or determined experimentally.

8.1. Manual equilibration

A defined volume of the sample/standard is transferred into a flask using a pipette. The flask is then attached tightly to the manifold.

Each manifold is cooled down to below - 80 °C to deep-freeze the samples (manifold equipped with capillary opening tubes do not require this freezing step). Subsequently, the whole system is evacuated. After reaching a stable vacuum the gaseous CO₂ working standard is allowed to expand into the various flasks. For the equilibration process each manifold is placed in a temperature controlled water-bath typically at 25°C ( 1 °C) for 12 hours (overnight). It is crucial that the temperature of the water-bath is kept constant and homogeneous.

After the equilibration process is completed, the resulting is transferred from the flasks to the sample side bellow of the dual inlet system. The measurements are performed by comparing several times the ratios of the contained in the sample side and the standard side ( reference standard gas) of the dual inlet. This approach is repeated till the last sample of the sequence has been measured.

8.2. Use of an automatic equilibration apparatus

A defined volume of the sample/standard is transferred into a vial using a pipette. The sample vials are attached to the equilibration system and cooled down to below - 80 °C to deep-freeze the samples (systems equipped with capillary opening tubes do not require this freezing step). Subsequently, the whole system is evacuated.

After reaching a stable vacuum the gaseous working standard is expanded into the vials. Equilibrium is reached at a temperature of typically 22 1 °C after a minimum period of 5 hours and with moderate agitation (if available). Since the equilibration duration depends on various parameters (e.g. the vial geometry, temperature, applied agitation ...), the minimum equilibrium time should be determined experimentally.

After the equilibration process is completed, the resulting is transferred from the vials to the sample side bellow of the dual inlet system. The measurements are performed by comparing several times the ratios of the contained in the sample side and the standard side ( reference standard gas) of the dual inlet. This approach is repeated till the last sample of the sequence has been measured.

8.3. Manual preparation manual and automatic equilibration and analysis with a dual inlet IRMS

A defined volume of sample / standard (eg. 200 μL) is introduced into a vial using a pipette. The open vials are then placed in a closed chamber filled with the used for equilibration (5.2.2). After several purges to eliminate any trace of air, the vials are closed and then placed on the thermostated plate of the sample changer. The equilibration is reached after at least 8 hours at 40 °C. Once the process of equilibration completed, the obtained is dried and then transferred into the sample side of the dual inlet introduction system. The measurements are performed by comparing several times the ratios of the contained in the sample side and the standard side ( reference standard gas) of the dual inlet. This approach is repeated till the last sample of the sequence has been measured.

8.4. Use of an automatic equilibration apparatus coupled to a continuous flow system

A defined volume of the sample/standard is transferred into a vial using a pipette. The sample vials are placed into a temperature controlled tray.

Using a gas syringe the vials are flushed with mixture of He and . The remains in the headspace of the vials for equilibration.

Equilibrium is reached at a temperature typically of 30 1 °C after a minimum period of 18 hours.

After the equilibration process is completed the resulting is transferred by means of the continuous flow system into the ion source of the mass spectrometer. reference gas is also introduced into the IRMS by means of the continuous flow system. The measurement is carried out according to a specific protocol for each kind of equipment.

Calculation

The intensities for m/z = 44, 45, 46 are recorded for each sample and reference materials analysed in a batch of measurements. The isotope ratios are then calculated by the computer and the software of the IRMS instrument according to the principles explained in section 6.1. In practice the isotope ratios are measured against a working standard previously calibrated against the V-SMOW. Small variations may occur while measuring on line due to changes in the instrumental conditions. In such a case the δ of the samples must be corrected according to the difference in the δ value from the working standard and its assigned value, which was calibrated beforehand against V-SMOW. Between two

measurements of the working standard, the variation is the correction applied to the sample results that may be assumed to be linear. Indeed, the working standard must be measured at the beginning and at the end of all sample series. Therefore a correction can be calculated for each sample using linear interpolation between two values (the difference between the assigned value of the working standard and the measurements of the obtained values).

The final results are presented as relative δ_V-SMOW values expressed in ‰.

δ_V-SMOW values are calculated using the following equation:

The δ value normalized versus the V-SMOW/SLAP scale is calculated using the following equation:

The δ_V-SMOW value accepted for SLAP is -55.5‰ (see also 5.1).

Precision

The repeatability (r) is equal to 0.24 ‰.

The reproducibility (R) is equal to 0.50 ‰.

Summary of statistical results

	General average (‰)	Standard deviation of repeatability (‰) s_r	Repeatability (‰) r	Standard deviation of reproducibility (‰) s_R	Reproducibility (‰) R
Water

Sample 1	-8.20	0.068	0.19	0.171	0.48
Sample 2	-8.22	0.096	0.27	0.136	0.38
Wine N° 1
Sample 5	6.87	0.098	0.27	0.220	0.62
Sample 8	6.02	0.074	0.21	0.167	0.47
Sample 9	5.19	0.094	0.26	0.194	0.54
Sample 4	3.59	0.106	0.30	0.205	0.57
Wine N° 2
Sample 3	-1.54	0.065	0.18	0.165	0.46
Sample 6	-1.79	0.078	0.22	0.141	0.40
Sample 7	-2.04	0.089	0.25	0.173	0.49
Sample 10	-2.61	0.103	0.29	0.200	0.56

Inter-laboratories studies

Bulletin de l’O.I.V. janvier-février 1997, 791-792, p.53 - 65.

Bibliography

[1] Allison, C.E., Francey, R.J. and Meijer., H.A., (1995) Recommendations for the Reporting of Stable Isotopes Measurements of carbon and oxygen. Proceedings of a consultants meeting held in Vienna, 1 - 3. Dec. 1993, IAEA-TECDOC-825, 155-162, Vienna, Austria.
[2] Baertschi, P., (1976) Absolute ¹⁸O Content of Standard Mean Ocean Water. Earth and Planetary Science Letters, 31, 341-344.
[3] Breas, O,. Reniero, F. and Serrini, G., (1994) Isotope Ratio Mass Spectrometry: Analysis of wines from different European Countries. Rap. Comm. Mass Spectrom., 8, 967-987.
[4] Craig, H., (1957) Isotopic standards for carbon and oxygen and correction factors for mass spectrometric analysis of carbon dioxide. Geochim. Cosmochim. Acta, 12, 133-149.
[5] Craig, H., (1961) Isotopic Variations in Meteoric Waters. Science, 133, 1702-1703[6] Craig, H., (1961) Standard for reporting concentrations of deuterium and oxygen-18 in natural waters. Science, 133, 1833-1834.
[7] Coplen, T., (1988) Normalization of oxygen and hydrogen data. Chemical Geology (Isotope Geoscience Section), 72, 293-297
[8] Coplen, T. and Hopple, J., (1995) Audit of V-SMOW distributed by the US National Institute of Standards and Technology. Proceedings of a consultants meeting held in Vienna, 1 - 3. Dec. 1993, IAEA-TECDOC-825, 35-38 IAEA, Vienna, Austria.
[9] Dunbar, J., (1982 Detection of added water and sugar in New Zealand commercial wines.). Elsevier Scientific Publishing Corp. Edts. Amsterdam, 1495-501.
[10] Epstein, S. and Mayeda, T. (1953) Variations of the ¹⁸O/¹⁶O ratio in natural waters. Geochim. Cosmochim. Acta, 4, 213 .
[11] Förstel, H. (1992) Projet de description d’une méthode : variation naturelle du rapport des isotopes ¹⁶O et ¹⁸O dans l’eau comme méthode d’analyse physique du vin en vue du contrôle de l’origine et de l’addition d’eau. OIV, FV n° 919, 1955/220792.
[12] Gonfiantini, R., (1978) Standards for stable isotope measurements in natural compounds. Nature, 271, 534-536.
[13] Gonfiantini, R., (1987) Report on an advisory group meeting on stable isotope reference samples for geochemical and hydrochemical investigations. IAEA, Vienna, Austria.
[14] Gonfiantini, R., Stichler, W. and Rozanski, K., (1995) Standards and Intercomparison Materials distributed by the IAEA for Stable Isotopes Measurements. Proceedings of a consultants meeting held in Vienna, 1 - 3. Dec. 1993, IAEA-TECDOC-825, 13-29 Vienna, Austria.
[15] Guidelines for Collaborative Study Procedures (1989) J. Assoc. Off. Anal. Chem., 72, 694-704.
[16] Martin, G.J., Zhang, B.L., Day, M. and Lees, M., (1993) Authentification des vins et des produits de la vigne par utilisation conjointe des analyses élémentaire et isotopique. OIV, F.V., n°917, 1953/220792.
[17] Martin, G.J., Förstel, H. and Moussa, I. (1995) La recherche du mouillage des vins par analyse isotopique ²H et ¹⁸O. OIV, FV n° 1006, 2268/240595
[18] Martin, G.J. (1996) Recherche du mouillage des vins par la mesure de la teneur en 18O de l’eau des vins. OIV, FV n° 1018, 2325/300196.
[19] Martin, G.J. and Lees, M., (1997) Détection de l’enrichissement des vins par concentration des moûts au moyen de l’analyse isotopique ²H et ¹⁸O de l’eau des vins. OIV, FV n° 1019, 2326/300196.
[20] Moussa, I., (1992) Recherche du mouillage dans les vins par spectrométrie de masse des rapports isotopiques (SMRI). OIV, FV n°915, 1937/130592.
[21] Werner, R.A. and Brand, W., (2001) Reference Strategies and techniques in stable isotope ratio analysis. Rap. Comm. Mass Spectrom., 15, 501-519.
[22] Zhang, B.L., Fourel, F., Naulet, N. and Martin, G.J., (1992) Influence de l’expérimentation et du traitement de l’échantillon sur la précision et la justesse des mesures des rapports isotopiques (D/H) et (¹⁸O/¹⁶O). OIV, F.V. n° 918, 1954/220792.

SECTION 3 - CHEMICAL ANALYSIS

Codified File

SECTION 3.1 - ORGANIC COMPOUNDS

SECTION 3.2 - NON ORGANIC COMPOUNDS

SECTION 4 - MICROBIOLOGICAL ANALYSIS

Codified File

Microbiological Analysis (Type-IV)

OIV-MA-AS4-01 Microbiological analysis of wines and musts- Detection, differentiation and counting of micro-organisms

Type IV method

Objective:

Microbiological analysis is aimed at following alcoholic fermentation and/or malolactic fermentation and detecting microbiological infections, and allowing the detection of any abnormality, not only in the finished product but also during the different phases of manufacture.

Comments:

All experiments must be carried out under normal microbiological aseptic conditions, using sterilized material, close to a Bunsen burner flame or in a laminar flow room and flaming the openings of pipettes, tubes, flasks, etc. Before carrying out microbiological analysis, it is necessary to ensure that the samples to be analyzed are taken correctly.

Field of application:

Microbiological analysis can be applied to wines, musts, mistelles and all similar products even when they have been changed by bacterial activity. These methods may also be used in the analysis of industrial preparations of selected microorganisms, such as dry active yeasts and lactic bacteria.

Microbiological analysis techniques:

Reagents and materials
Installations and equipment
Sampling
Quality tests
1. Objective
2. Principle
3. Procedure
  1. air quality tests
  2. incubator quality tests
Microscopic techniques for the detection, differentiation of micro-organisms and direct counting of yeasts
1. Microscopic examination of liquids or deposits
2. Gram staining for the differentiation of bacteria isolated from colonies (see paragraph 6)
3. Catalase Test for the differentiation of bacteria isolated from colonies (see paragraph 6)
4. Yeast cell count – haemocytometry
5. Yeast cell count – methylene blue staining of yeast cells
Counting of micro-organisms by culture
1. Detection, differentiation and enumeration of microorganisms (plate count)
2. Culture in liquid environment - "Most Probable Number" (MPN).

Reagents and materials

Current laboratory equipment and apparatus, as listed in ISO 7218:2007 - Microbiology of food and animal feeding stuff - General rules for microbiological examinations.

The following ones are recommended:

Common laboratory materials and glassware, sterile (sterilized or ready-to-use sterile).
Tubes (16x160 mm or similar) containing 9 ml sterile peptone water (Tryptone: 1 g/l) or other diluents to be used for serial sample dilutions.
Ethanol to flame spreaders and tweezers.
Hydrogen peroxide 3% solution.
Micropipette holding sterile tips: 1 ml and 0.2 ml.
L-shaped or triangular-shaped bent glass rods (hockey sticks) or plastic spreaders.
Stainless steel tweezers, with flat edges.
Sterile cellulose ester membranes (or equivalent) porosity 0.2 and 0.45 µm, 47 mm or 50 mm diameter, possibly with a printed grid on the surface, and packed singularly.
Sterile cylinders.
10 ml sterile pipettes.

Installations and equipment

Current laboratory equipment and apparatus, as listed in ISO 7218:2007 - Microbiology of food and animal feeding stuff - General rules for microbiological examinations.

The following ones are recommended:

Microbiological cabinet or laminar flow cabinet. In the absence of this device, work in the proximity (within 50 cm) of a gas burner.
Balance, with an accuracy of ± 0.01 g.
Autoclave.
Incubator with settings ranging from 25°C to 37°C.
pH meter, with an accuracy of ± 0,1 pH units and a minimum measuring threshold of 0,01 pH units.
Refrigerator(s), set at 5 ± 3°C, and freezer(s), which temperature shall be below –18°C, preferably equal to – 24 ± 2°C.
Thermostatically controlled bath, set at 45 1°C
Microwave oven.
Optical microscope.
Gas burner.
Colony-counting device.
Equipment for culture in a modified atmosphere (a sealed jar in which anaerobiosis can be made).
Filtering apparatus with 47 mm or 50 mm diameter filters.
"Vortex" stirrer or equivalent.
Incubator for dry heat sterilisation
Centrifuge
Pump

Sampling

The sample must reproduce the microbiology of the whole mass of must or wine to be analyzed. As far as possible, the mass must be homogenized before sampling, in order to resuspend microorganisms that tend to set down to the bottom of the container. In case the homogenization is undesirable, samples must be taken from where the microorganisms are likely (or suspected) to be present (i.e. when searching for yeasts lying in the bottom of tanks or barrels), but in this case results are not quantitative. Before taking a sample from a tap, this latter must be flamed, and 2-3 litres liquid must be flushed. The sample must be put in a sterile.

The sample must be kept refrigerated and analysed as quickly as possible.

The following amounts of samples are required for the microbiological examination:

Must, or fermenting must or wine in storage: not less than 250 ml;

Bottled or packed wine: not less than one unit, whateverthe capacity;

Quality tests

4.1. Objective

These tests are aimed at detecting the risk of microbial infection in advance.

4.2. Principle

This technique is based on organoleptic and appearance changes (clouds, films, deposits, unusual colors) shown by wine when subjected to certain aeration and temperature conditions which can bring about microbiological activity. The nature of the changes should be confirmed by microscopic examination.

4.3. Operating method

4.3.1. Air quality tests

A 50 mL wine sample after filtration on coarse sterile filter paper is placed in a 150 mL sterile conical flask stoppered with cotton and left at an ambient temperature for at least 3 days. The clarity, color and possible presence of clouds, deposits and films are examined over this time. A microscopic examination is carried out in the case of cloud, deposit or film or a color change.

4.3.2. Incubator quality tests

A 100 mL wine sample, after filtration on coarse sterilized filter paper, is placed in 300 mL sterile conical flask stopped with cotton, put in an incubator at 30°C and examined after at least 72 hours. Organoleptic or visible changes can be indicative of microbial development. A microscopic examination must therefore be made.

Microscopic techniques for the detection and differentiation of micro-organisms, and for the direct counting of yeasts

5.1. Microscopic examination of liquids or deposits

Objective:

Microscopic examination under cool conditions is aimed at detecting and differentiating the yeasts from the bacteria that might be present, in terms of their size and shape. Microscopic observation cannot distinguish between viable and non-viable microorganisms.

Comment:

With appropriate staining (see below), an estimation of the viable yeasts can be made.

Principle:

This technique is based on the magnification made by a microscope that allows the observation of micro-organisms, whose size is on the order of a micron.

Operation method:

Microscopic examination can be carried out directly on the liquid or on the deposit.

Direct observation of the liquid will only be useful when the population is sufficiently high (more than 5 x 10⁵ cells/mL).

When wine shows a lower microorganism population, it is necessary to concentrate the sample. Thus, about 10 mL of homogenized wine is centrifuged at 3000 - 5000 rpm for 5 to 15 minutes. After decanting the supernatant, the deposit is re-suspended in the liquid remaining at the bottom of the centrifugation tube.

To carry out the microscopic observation, a drop of the liquid sample or the homogenized deposit is placed on a clean glass slide with a Pasteur pipette or a sterilized wire. It is covered with a cover glass and placed on a slide on the stage of the microscope. Observation is made in a clear field, or preferably in phase contrast, which allows a better observation of detail. A magnification of x400 - x1000 is generally used.

5.2. Gram staining for the differentiation of bacteria isolated from colonies (see paragraph 6)

Objective:

Gram staining is used to differentiate between lactic bacteria (Gram positive) and acetic bacteria (Gram negative) and also to observe their morphology.

Comments:

It must be remembered that Gram staining is not sufficient to reach a conclusion, as other bacteria in addition to lactic and acetic bacteria may be present.

Principle:

This color is based on the difference in the structure and chemical composition of the cell walls between Gram positive and Gram negative bacteria. In Gram negative bacteria, the cell walls that are rich in lipids have a much reduced quantity of peptidoglycan. This allows the penetration of alcohol and the elimination of the gentian-violet-iodine complex, forming when the colorless cell is left, which will then be re-colored in red by saffron. Conversely, the cell walls of Gram positive bacteria contain a large quantity of peptidoglycan and a low concentration of lipids. Thus, the thick peptidoglycan wall and the dehydration caused by the alcohol do not allow the alcohol to eliminate the coloring of the gentian-violet-iodine complex.

Gram staining loses its usefulness if it is performed on a culture that is too old. Thus, the bacteria must be in an exponential growth phase within 24 to 48 hours. Gram staining is carried out after isolating the colonies and liquid cultivation.

Solutions:

The water used must be distilled.

1. Gentian violet solution

Preparation: Weigh 2g of gentian violet (or crystal violet), and put into a 100 mL conical flask and dissolve in 20 mL of 95% vol. alcohol. Dissolve 0.8g of ammonium oxalate in 80 mL of distilled water. Mix the two solutions together and only use after a period of 24 hours. Filter through paper at time of use. Keep out of light in a dark flask.

2. Lugol solution

Preparation: Dissolve 2g of potassium iodide in a minimal quantity of water (4 to 5 mL) and dissolve 1g of iodine in this saturated solution. Make the volume up to 300 mL with distilled water. Keep out of light in a dark flask.

3. Saffranin solution:

Preparation: Weigh 0.5g of saffranin in a 100 mL conical flask, dissolve with 10 mL of 95% vol. alcohol and add 90 mL of water. Stir. Keep out of light in a dark flask.

Operating method:

Smear preparation

Make a subculture of the bacteria in liquid or solid medium. Collect the young culture bacteria from the deposit (after centrifugation of the liquid culture) or directly from the solid medium with a loop or wire and mix in a drop of sterilized water.

Make a smear on a slide, spreading a drop of the microbial suspension. Let the smear dry, and then carry out fixation, rapidly passing the slide 3 times through the flame of a Bunsen burner, or equivalent. After cooling, perform staining.

Staining

Pour a few drops of gentian violet solution onto the fixed smear. Leave to react for 2 minutes and wash off with water.

Pour in 1 to 2 drops of lugol solution. Leave to react for 30 seconds. Wash with water and dry with filter paper.

Pour on 95% vol. alcohol, leave for 15 seconds. Rinse with water and dry with filter paper.

Pour on a few drops of saffranin solution, leave to react for 10 seconds. Wash with water and dry with filter paper.

Place a drop of immersion oil on the smear.

With the immersion objective, observe through a microscope in clear field.

Results:

Lactic bacteria remain violet or dark blue colored (Gram positive). Acetic bacteria are red colored (Gram negative).

5.3. Catalase Test for the differentiation of bacteria isolated from colonies (see paragraph 6)

Objective:

This test is aimed at making a distinction between acetic and lactic bacteria. The yeasts and acetic bacteria have a positive reaction. Lactic bacteria give a negative response.

Comments:

It must be taken into account that the catalase test is insufficient as other bacteria in addition to lactic and acetic bacteria may be present.

Principle:

The catalase test is based on the property that aerobic micro-organisms have of decomposing hydrogen peroxide with release of oxygen:

Reagent:

12 Volume hydrogen peroxide solution (3%)

Preparation: Measure 10 mL of 30% by volume hydrogen peroxide in a 100 mL calibrated flask and fill with freshly boiled distilled water. Stir and keep in the refrigerator in a dark flask. The solution must be freshly prepared.

Operating method:

Place a drop of 3% by volume hydrogen peroxide on a slide and add a small sample of young colony. If gas is released, it can be concluded that catalase activity is occurring in the culture . It is sometimes difficult to observe gas clearing immediately, particularly with bacterial colonies. It is therefore advisable to examine the culture through a microscope (objective x10).

5.4. Yeast cell count – Haemocytometry

5.4.1. Scope

Determination of yeast cell concentration in fermenting musts or wines, and ADY (Active Dry Yeast). A high cell concentration is required: at least 5 × 10⁶ cells/ml. Fermenting musts and wines can be counted directly, ADY must be diluted 1000 or 10 000 times. Musts or wines containing fewer cells must be centrifuged (3000 g, 5 minutes) and the sediment resuspended in a known volume.

5.4.2. Principle

A drop of yeast cell suspension is placed on the surface of a slide with a counting chamber. The counting chamber has a defined volume and is subdivided in squares on the surface of the slide. Counting is made under a microscope in light field. Phase contrast is not indicated if cells are stained,

5.4.3. Reagents and materials

-Haemocytometer, double chamber, preferably with clips: Bürker, Thoma, Malassez, Neubauer.
Haemocytometer cover slip: common (0.17 mm width) cover slips are not suitable to this use, because they are flexible and do not guarantee that the chamber width is constant.
Pipettes, fine tips, 1 and 10 ml volume.
Volumetric flask, 100 ml.
Beaker, 250 ml.
1. Installations and equipment

Microscope with bright field illumination: magnification 250-500 x. Phase contrast is contraindicated.
Magnetic plate and stirring bar.

Haemocytometers are available with different counting chambers: Bürker, Thoma, Malassez, Neubauer. Confirm the identity and the volume of the counting chamber to be used. Bürker, Thoma and Neubauer chambers have 0.1 mm depth, Malassez chamber is 0.2 mm deep.

Thoma chamber has one central large (1 mm²) square, so its volume is 0.1 mm³ (10^-4 ml). This large square is subdivided in 16 squares, themselves further divided in 16 smaller squares. Thes small squares each have 0.05 mm x 0.05 side and 0.1 mm depth, so that the volume of each small square is 0.00025 mm³ (25 x 10^-8 ml). It is also possible to count in the medium squares, each medium square having 16 small squares 0.2 x 0.2 mm, and 0.004 mm³ area, or 4 x 10^-6 ml volume.

Bürker chamber contains 9 large 1mm² squares, which are divided into 16 0.2mm sided medium squares, separated by double lines with a 0.05mm spacing. The area of the medium squares is 0.04mm² and the volume is 0.004mm³. The area of the small squares formed by the double lines have an area of 0.025mm².

Big, medium and small squares of Neubauer, Thoma and Bürker chambers have the same size. Bürker chamber medium squares do not contain other lines inside; therefore they are probably the easiest to count.

5.4.5. Examination techniques

The counting chamber and the cover slip must be clean and dry before use. It may be necessary to scrub the ruled area, as dirty chambers influence the sample volume. Clean with demineralised water, or ethanol, and dry with soft paper.

If flocculent yeast has to be counted, the suspension medium must be 0.5% sulphuric acid, in order to avoid flocculation, but this impairs the possibility of methylene blue staining and the count of viable and dead cells. Resuspension can be carried out by sonification.

Put the sample on the slide using a fine tip pipette, following one of the two following procedures.

Procedure 1

Mix well the yeast suspension. If dilutions are required, make decimal dilutions, as usual. If a methylene blue stain is performed, make it on the most diluted sample and mix 1 ml sample with 1 ml methylene blue solution.

Constantly shake the yeast suspension. Take a sample with a fine tip pipette, expel away 4-5 drops of suspension and place a small drop of yeast suspension (diluted if necessary) on each of the two ruled areas of the slide. Cover it with the cover slip within 20 seconds and press firmly with the clips. The counting area should be completely filled, but no liquid should extend to the moat.

Procedure 2

Place the rigid cover slip so that both counting chambers are equally covered. Use the clips to press the cover slip against the support areas until iridescence lines (the Newton rings) appear. When there are no clips, do not move the cover slip when filling the chamber.

Constantly shake the yeast suspension. Take a sample with a fine tip pipette, expel away 4-5 drops of suspension and allow a small drop of sample to flow between the haemocytometer and the cover slip. Do the same in the other part of the slip. The counting area should be completely filled, but no liquid should extend to the moat.

Let the prepared slide stand for three minutes for the yeast cells to settle, and place it under the microscope.

Count 10 medium squares in each ruled area, standardizing procedures must be set, in order to avoid counting twice the same square. Cells touching or resting on the top or right boundary lines are not counted, those resting on bottom or left boundary lines are counted. Budding yeast cells are counted as one cell if the bud is less than one-half the size of the mother cell, otherwise both cells are counted.

To obtain accurate cell counts, it is advisable to count 200 – 500 total yeast cells, on average. Counts from both sides of the slide should agree within 10%. If a dilution is used, the dilution factor must be used in the calculation.

5.4.6. Expression of results

If C is the average number of cells counted in one medium square with 0.2 mm sides, the population T total in the sample is :

Expressed as cells/mL

T= C x 0.25 x10⁶ x dilution factor

If C is the average number of cells counted in one small square with 0.05mm sides, the population T total in the sample is:

Expressed as cells/mL

T= C x 4 x10⁶ x dilution factor

5.4.7. References

European Brewery Convention. Analytica Microbiologica – EBC. Fachverlag Hans Carl, 2001

5.5. Yeast cell count – Methylene blue staining of yeast cells

5.5.1. Scope

This method allows a rapid estimation of the percentage of viable yeast cells, which are not stained, because dead cells are blue-stained. The method is applicable to all samples containing yeasts, except musts containing more than 100 g/l sugar. Bacteria are too small and their staining is not visible with this method.

Note: a good focus should be achieved at various depths, in order to properly see their coloring with methylene blue.

5.5.2. Principle

Methylene blue is converted into its colourless derivative by the reducing activity of viable yeast cells. Dead yeast cells will be stained blue.

Viability is calculated from the ratio between the number of viable cells and the total number of cells. The method overestimates “real” viability when viable cells are less than 80%, because it does not distinguish between “live” cells and their ability to reproduce (Viable But Not Culturable cells).

If the sugar concentration is higher than 100 g/l, most cells are light blue, therefore this method is not recommended.

If wine has low pH and is strongly buffered, the dye cannot work properly. In this case the count must be applied at least to the first decimal dilution.

5.5.3. Reagents and materials

Solution A: Methylene blue distilled water solution, 0.1 g/500 ml.
Solution B: , distilled water solution, 13.6 g/500 ml.
Solution C: x 12 distilled water solution, 2.4 g/100 ml
Solution D: 498.75 ml Solution B + 1.25 ml solution C.
Solution E: Mix the 500 ml of solution D with 500 ml solution A to give final buffered methylene blue solution, with pH approximately 4.6.

5.5.4. Installations and equipment

Microscope, 250-500 x magnifications. Phase contrast is contraindicated.

Microscope slides and cover slips, or haemocytometer (Thoma, Bürker or Neubauer chamber).

Test tube and stirring rod.

Pipettes, fine tips.

5.5.5. Examination techniques

Viability determination

Dilute the suspension of yeast with methylene blue solution in a test tube until the suspension has approximately 100 yeast cells in a microscopic field. Place a small drop of well-mixed suspension on a microscope slide and cover with a cover slip.

Examine microscopically using a magnification of 400 x within 10 minutes contact with the stain.

Count a total of 400 cells (T), noting the number of blue coloured (C) dead, broken, shrivelled and plasmolyzed cells. Budded yeast cells are counted as one cell if the bud is less than one half the size of the mother cell. If the bud is equal or greater than one half the size of the mother cell, both are counted. Cell stained light blue should be considered alive.

5.5.6. Expression of results

If T is the total cell number and C the blue coloured cell number, then the percentage of viable cells is

5.5.7. References

European Brewery Convention. Analytica Microbiologica – EBC. Fachverlag Hans Carl, 2001

Counting of micro-organisms by culture

Objective:

The purpose of counting of microorganisms by culture is to evaluate the level of contamination of the sample, that is to say, to estimate the quantity of viable microorganisms. According to the culture media used and the culture conditions, four types of microorganisms can be counted, namely, yeasts, lactic bacteria, acetic bacteria and mould.

Principle:

Enumeration by culture is based on the fact that micro-organisms are able to grow in a nutrient medium and incubation conditions suitable to form colonies on the medium solidified by agar, or turbidity in a liquid medium. On an agar medium a cell produces bv proliferation a cluster of cells visible to the naked eye called colony.

6.1. Detection, differentiation and enumeration of microorganisms (plate count).

6.1.1. Scope

This standard gives general guidance for the enumeration of viable yeasts, moulds and lactic or acetic bacteria in musts, concentrated musts, partially fermented musts, wines (including sparkling wines) during their manufacture and after bottling, by counting the colonies grown on a solid medium after suitable incubation. The purpose of microbiological analysis is to control the winemaking process and prevent microbial spoilage of musts or wines.

6.1.2. Terms and definitions

The terms “plate” and “Petri dish” are used as synonyms.

CFU = Colony Forming Units.

6.1.3. Method

The number of viable microorganisms present in musts or wines is determined by spreading a small known volume of sample on the surface of a culture medium or adding it as per the incorporation method (see par. 9.5 6.1.7.4), and incubating the plates for the required time in the better conditions for the growth of the microorganisms. Each cell, or cluster of cells, divides and gathers into a cluster and becomes visible as a colony. The number of colonies found on the surface of a plate states for the cells occurring in the original sample so that the results are reported as CFU. If the number of cells in a sample is supposed to be high, suitable serial decimal dilutions are performed in order to obtain colonies ranging from 15 10 to 300 per plate. If the number of CFU in a sample is supposed to be low, they are collected on the surface of a sterile 0.45 to 0.88 μm filter for yeasts of 0.22 to 0.45 µm and for bacteria, which is then placed in the Petri dish on the surface of the culture medium.

The measuring range of this method rises from < 1 CFU/(analyzed volume) to 10⁹ CFU/ml or 10¹⁰ CFU/g in the original sample.

6.1.4. Reagents and materials

As indicated in paragraph 1 of the resolution, plus:

Tubes (16x160 mm or similar) containing 9 ml sterile peptone water (Tryptone: 1 g/l) or other diluents to be used for serial sample dilutions (Appendix 4). An indicative number of tubes required for the following samples is reported below:

Unfermented musts: 4 / sample.

Fermenting musts:7 / sample.

Wines in storage: 2 / sample.

Micropipette holding sterile tips: 1 ml and 0.2 ml.

L-shaped or triangular-shaped bent glass rods (Drigalski rods) or plastic spreaders.

90-mm diameter Petri dishes (56 cm²) (with 15-20 ml of growth medium) for pour plate technique, and 90-mm or 60-mm diameter plates (with 6-8ml of growth medium)for membrane filter technique, filled 18-24 h in advance with 15-20 ml of culture medium (simple or double dishes are required for each sample tested):

For yeasts counts use: YM, YEPD, WL Nutrient Agar, YM Agar or TGY Agar. If searching non-Saccharomyces yeasts, Lysine Agar and WL Differential Agar plates (AppendixAppendix 5, culture medium) or equivalent if validated.

For acetic acid bacteria counts use: GYC agar, G2 or Kneifel medium (AppendixAppendix 5, culture medium) or equivalent if validated

For lactic acid bacteria counts use: MRS plus 20% tomato (or apple- or grape-) juice, or modified ATB Agar (medium for Oenococcus oeni), or TJB plus agar, or Milieu Lafon-Lafourcade, milieu 104, MTB agar (AppendixAppendix 5 culture medium) or equivalent if validated

For filamentous fungi counts use Czapek-Dox modified agar, DRBC agar or MEA added with tetracycline (100 mg/l) and streptomycin (100 mg)l). (Appendix 5 culture medium) or equivalent if validated

Antibiotics must be added in order to make the counting selective since all the microorganisms are together in wine.(see Appendix I culture media)

6.1.5. Installations and equipment

As indicated in paragraph 2 of the resolution.

6.1.6. Sampling

As indicated in paragraph 3 of the resolution

The following amounts of samples are required for the plate counting:

Must, or fermenting must or wine in storage: not less than 250 ml;

Bottled or packed wine: not less than one unit,whatever the capacity;

6.1.7. Examination techniques

6.1.7.1. Preliminary requisites

All the materials and equipments used in the tests must be sterile, and aseptic condition must be kept during all operations.

The laminar flow cabinet must be switched on 5 minutes before starting the work, in order to have a sterile and stable air flow.

6.1.7.2. Sterilization

Culture media must be sterilized in autoclave at 121°C for at least 15 minutes (20 minutes for large volumes). Single-use sterile materials and glassware must be opened and used under laminar flow cabinet. Tweezers and spreading devices must be immersed in ethanol and flamed before use. Stainless steel funnels must be flamed with ethanol after each use, while glass- and polycarbonate funnels must be autoclaved before use, so these ones must be available in the same number as the tested samples.

6.1.7.3. Sample dilution (Appendix 1)

One ml of sample is pipetted in a sterile 9 ml peptone water tube. The tube is stirred with the aid of a “vortex” shaker for 20 seconds. This is the first (decimal) dilution, from which 1 ml is transferred to the next 9-ml sterile peptone water tube, which is the second dilution. After 20 seconds shaking, the operation is repeated until necessary.

The indicative number of serial dilutions required for the following samples is reported below:

Unfermented musts: 4 decimal dilutions.

Fermenting musts: 7 decimal dilutions.

Unfiltered wines during ageing (Yeast counts): 2 decimal dilutions.

Unfiltered wines during ageing (Lactic Acid Bacteria counts) : 6 decimal dilutions.

Filtered wines or packed (bottled) wines No dilution.

Concentrated musts Dilute 10 ml in 100 ml peptone water (or 100ml in 1000ml).

Bottled or filtered wines, and concentrated musts after dilution in sterile peptone water, are analyzed with membrane filter technique.

6.1.7.4. Plating

The necessary serial dilutions are prepared for the number of samples to be plated. Multiple serial dilutions can be prepared, if many samples have to be plated, but any dilution must be plated within 20 minutes.

Inoculate each plate with 0.1 or 0.2 ml of the three lowest dilutions prepared, as follows:

Unfermenting musts: dilutions -2; -3; -4.

Fermenting musts: dilutions -5; -6; -7.

Unfiltered wines during ageing :dilutions 0; -1; -2.

In doubt, inoculate a higher number of dilutions, never a lower.

Under aseptic conditions (preferably under a laminar flow cabinet) spread the sample on the surface of the culture media before the liquid is absorbed (usually within 1-2 minutes) with a sterile bent glass rod (Drigalski rods) or a single-use one. A separate “hockey stick” must be used for each plate, or the plate must be spread starting with the most diluted sample and proceeding to the least dilute ones. Leave the plates some minutes under sterile air flow, until the liquid is absorbed.

Note 1: Plating 0.,2 ml instead of 0.1 ml, as frequently reported, allows an easier spreading and a delayed one. Calculations must consider this.

Note 2: For the enumeration of yeast Bacterial growth is avoided by adding 50 mg/l chloramphenicol (or equivalent if validated) to growth media, after autoclaving it, and the mold by adding biphenyl 150mg/L (or equivalent if validated).

Note 3: For the enumeration of lactic acid bacteria, yeasts growth is prevented by the addition of natamycin (pimaricin) (0.1 g/L) (or equivalent if validated) and acetic bacteria by anaerobic incubation.

Note 4: For the enumeration of acetic bacteria, the growth of yeast is prevented by the addition of natamycin (pimaricin) (0.1 g/L) (or equivalent if validated) and that of lactic acid bacteria with the addition of penicillin (12.5 mg/L) (or equivalent if validated).

The addition of antibiotics is done after the autoclave sterilization.

If a specific research of non-Saccharomyces yeast is performed, inoculate as previously described, three Lysine Agar plates and three WL Differential Agar plates with the appropriate dilutions

Incorporation method (alternative method).

Prepare and sterilize 15 ml of medium in tubes, and keep the tubes in a water bath (or equivalent if validated) at 471°C.

Pour 1 ml of sample or dilution in an empty Petri dish.

Add 15 ml culture medium and stir gently the Petri dish, so as to obtain a homogeneous distribution of microorganisms within the mass of the medium.

Allow to cool and solidify by placing the Petri dishes on a cool horizontal surface (the solidification time of the agar shall not exceed 10 min).

6.1.7.5. Enumeration with concentration by membrane filtration

Membrane porosity must be 0.45 or 0.8 µm for yeast counting; 0.2 or 0.45 μm for counting bacteria. Membrane surface must be preferably be cross-hatched, in order to facilitate the colony counting.

The plates, on which the membranes are put, can contain an agar nutrient medium or a pad, in which the dry medium is dispersed, that must be soaked with sterile water just before the use. Some suppliers give sterile plates containing a sterile pad, on which the content of 2-ml of single-use sterile liquid medium is poured just before the use.

Aseptically assemble the filtration equipment, sterilize the funnel according to 9.2, and connect to the vacuum-producing system.

Dip the tweezers in ethanol and flame them: when the flame is extinguished, wait some seconds and put the membrane, with the tweezers, on its holder of the filtration unit.

Before opening the bottle, shake it well; dip the bottleneck upside-down in ethanol (1-2 cm) and flame to sterilize it.

Of each sample sample three amounts: 10 ml with a sterile 10-ml pipette, 100 ml with a sterile cylindrical 100-ml pipette, and the rest direct from the bottle, if possible. To filter the wine, pour the wine into the funnel.

When the desired amount of wine has been filtered, release the vacuum, flame the tweezers, open the funnel, keep the membrane with the tweezers, put its opposite edge on the solid medium of a plate and make it adhere to the medium surface, avoiding bubble formation beneath.

6.1.7.6. Sample incubation

Incubate the plates, upside-down, aerobically 4 days at 25 2 C, for yeast or for acetic acid bacteria. If temperature is < 23°C extend incubation one more day, if temperature is < 20°C extend three more days. The maximum temperature must not exceed 28°C.

In case of performing Brettanomyces (or Dekkera) yeast counts, increase twofold the incubation time.

In case of performing LAB count, put the plates in an anaerobic jar or bag, and incubate the plates upside-down 10 days at 30 2 C. If temperature is < 28°C extend incubation one more day, if it is < 25°C extend three more days. The maximum temperature must not exceed 33°C.

6.1.8. Expression of results

6.1.8.1. Counting yeast colonies and bacteria.

Count the colonies grown in 4 days for the yeast and acetic acid bacteria (8 days for Brettanomyces/Dekkera yeasts), and 10 days for lactic bacteria, if necessary with the aid of a colony counter, ignoring the different colony morphology if performing a total yeast count, or considering it, if required.

The media and incubation conditions are specific enough for it to be possible to count the different types of micro-organisms in the colonies visible to the naked eye.

6.1.8.2. Calculation of results.

The most reliable results come from counting plates containing from 10 to 300 colonies (ISO 7218:2007 - Microbiology of food and animal feeding stuff - General rules for microbiological examinations).

Calculate the number N of microorganisms present in the test sample as a weighted mean from two successive dilutions using the following equation:

where

is the sum of colonies counted on the two dishes retained from two successive dilutionns, at least one of which contains a minimum of 10 colonies.
V is the volume of the inoculum placed in each dish, in millilitres.
d is the dilution corresponding to the first dilution retained [d=1 when the undiluted liquid product (test sample) is retained].

In other words, if plates from two consecutive decimal dilutions contain 10-300 colonies, compute the number of CFU/ml for each dilution, and then the average of the two values: this is the CFU/ml value of the sample. If one value is greater than the double of the other, keep the lower one as CFU/ml.

Round off the results to two significant figures only at the time of conversion to CFU/ml, and express the results as a number between 1,0 and 9,9 multiplied by the appropriate power of 10 (ISO 7218:2007 - Microbiology of food and animal feeding stuff - General rules for microbiological examinations).

If samples were inoculate in duplicate series, and one or two plates, inoculated with the same dilution, contain colonies, compute the average of the number of colonies and multiply by the reciprocal of the dilution factor, to obtain the number of CFU/ml.

If there is no plate containing 10-300 colonies, and all plates contain more than 300 colonies, count the less crowded ones. If they contain less than 10 colonies/cm², count 12 squares of 1 cm² and multiply the average by 56 (the area of a 90-mm diameter plate); if colonies are more crowded, count 4 squares of 1 cm² and multiply the average by 56. Express the results as “Estimated CFU/ml”. Do not express the results as TNTC (Too numerous to count) whenever possible.

If the only plates containing colonies contains less than 10 colonies, but at least 4, calculate the result as given in the general case, and report it as “Estimated CFU/ml”.

If the total is from 3 to 1, the precision of the result is too low, and the result shall be reported as “(the searched microorganisms) are present but less than 4 × d CFU/ml”.

If plates from all dilutions of any sample have no colonies, report the results as “less than 1/d CFU/ml”, but consider the possible presence of inhibitors in the sample.

When performing membrane filtration technique, express the results referring to the amount of filtered liquid, e.g. CFU/bottle, CFU/100 ml, or CFU/10ml.

6.1.9. Uncertainity of measure

6.1.9.1. Criteria of controlling the results.

For each lot of medium, one plate is used as sterility control after sterilization. One plate per each culture medium used during the tests, is left opened under laminar flow cabinet during all operations, as a sterility check of the working environment. That plate will be incubated as the inoculated ones.

Periodically, one sample is inoculated in double, and the experimental K_p is calculated with the following equation:

where and are the results of the two counts.

If Kp < 1.96 ≈ 2.,0 the results are acceptable: the average of the two counts can be used as the result.

If 2.0<Kp ≤ 2.576 ≈ 2.6 the difference of the two counts is critical, and must be carefully evaluated before accepting the results as the average of the two counts.

If Kp >2.6 the difference of the two counts is anomalous. The result is rejected and the test must be repeated. In such event the person in charge of the laboratory must examine all the results obtained after the last acceptable ones.

6.1.9.2. Uncertainty of measure

If the number of counted colonies in the countable plate is lower than 10, the result is acceptable, but the population of colonies is considered to follow the Poisson distribution. The 95% confidence level, and consequently the uncertainty of measure, of the estimated count made on a single Petri dish, is reported in the following table.

	Number of. colonies		Confidence limit at 95% level				Percent error of the limit *
			Lower		Upper		Lower		Upper
	1		<1		6		-97		457
	2		<1		7		-88		261
	3		<1		9		-79		192
	4		1		10		-73		156
	5		2		12		-68		133
	6		2		13		-63		118
	7		3		14		-60		106
	8		3		16		-57		97
	9		4		17		-54		90
10		5		18		-52		84
11		6		20		-50		79
12		6		21		-48		75
13		7		22		-47		71
14		8		24		-45		68
15		8		25		-44		65
* Compared to the microrganism count (1^st column)

If the colony count is >10, the confidence limit at a p probability level is calculated with the following equation:

where is the number of colonies on the plate, and K_p is the coverage factor. Usually the coverage factor is 2, or 1.96. C value is calculated from each plate and multiplied by the number of dilutions, together with the result of the count.

6.2. Culture in liquid medium- "Most Probable Number" (MPN)

6.2.1. Objective

The purpose of this technique is to evaluate the number of viable microorganisms in wines having high contents of solid particles in suspension and/or high incidence of plugging.

6.2.2. Principle

This technique is based on the estimation of the number of viable microorganisms in liquid medium, starting from the principle of its normal distribution in the sample.

6.2.3. Diluents and liquid culture media (see Appendices 4 and 5)

6.2.4. Operating method

Several quantitative and successive solutions are prepared and following this, after incubation, a certain proportion of tests will not lead to any growth (negative tests), while others will begin to grow (positive tests). If the sample and the dilutions are homogeneous, and if the number of dilutions is sufficiently high, it is possible to treat the results statistically, using suitable tables (tables based on McCrady's probability calculations), and to extrapolate this result to the initial sample.

6.2.5. Preparation of dilutions

Starting from a sample of homogenized wine, prepare a series of decimal dilutions (¹/₁₀) in the diluent.

Take 1 mL of wine and add to 9 mL of diluent in the first tube. Homogenize. Take 1 mL of this dilution to add to 9 mL of diluent in the second tube. Continue this dilution protocol until the last suitable dilution, according to the presumed microbial population, using sterilized pipettes for each dilution. The dilutions must

be made until extinction, i.e. the absence of development in the lowest dilutions (appendix 2).

6.2.6. Preparation of inoculations

Inoculate 1 mL of wine and 1 mL of each of the prepared dilutions, mixed at the time, in, respectively, 3 tubes with the appropriate culture medium (appendix 5). Mix thoroughly.

Incubate the inoculated tubes in the incubator at 25°C for yeasts (3 days, up to 10 days), under aerobic conditions, and for lactic bacteria, under anaerobic or microaerophilic conditions (8 days, up to 10 days), making periodic observations up to the last day of incubation.

6.2.7. Results

All those tubes that show a microbial development leading to the formation of a whitish deposit, more or less evident and/or with a more or less marked disturbance are considered as positive. The results must be confirmed by observation through a microscope. Specify the incubation period.

The reading of the tubes is made by noting the number of positive or negative tubes in each combination of three tubes (in each dilution). For example, "3-1-0" signifies: 3 positive tubes in the 10⁰ dilution (wine), 1 in the 10^-1 dilution and zero in the 10^-2 dilution.

For a number of dilutions higher than 3, only 3 of these results are significant. To select the results allowing for the determination of the "MPN", it is necessary to determine the "typical number" according to the examples in the following table:

Table:

Number of positive tubes for each dilution						Typical number
Example	10	10	10	10	10	3-1-0
a	3	3	3	1	0	3-2-0
a	3	3	2	0	0	3-2-1
a	3	2	1	0	0	3-0-1
a	3	0	1	0	0	3-2-3
b	3	2	2	1	0	3-2-3
b	3	2	1	1	0	3-2-2
c	2	2	2	2	0	2-2-2
d	0	1	0	0	0	0-1-0
Example a : take the greatest dilution for which all the tubes are positive and the two following ones. Example b : if a positive result is achieved for a dilution that is bigger than the last chosen dilution, it must be added. Example c : if no dilution achieves three positive tubes, take the dilutions that correspond to the last three positive tubes. Example d : instance of a very small number of positive tubes. Choose the typical number so that the positive dilution is in the ten’s row.

Adapted from Bourgeois, C.M. and Malcoste, R. in : Bourgeois,

C.M. et Leveau, J.Y. (1991).

Calculation of the Most Probable Number (MPN)

Taking account of the typical number obtained, the MPN is determined through Table A (Appendix 3) based on McCrady's probability calculations, considering the dilution made. If the dilution series is 10⁰ ; 10^-1 ; 10^-2 the reading is direct. If the dilution series is 10¹; 10⁰; 10^-1 the reading is 0.1 times this value. If the dilution series is 10^-1; 10^-2; 10^-3; the reading is 10 times this value.

Comment:

If there is a need to increase the sensitivity, a concentration 10¹ of wine can be used. To obtain this concentration of microorganisms in 1 mL, centrifuge 10 mL of wine and take 1 mL of deposit (after having taken 9 mL of excess liquid) and inoculate according to the previously described method.

6.2.8. Expression of Results

The microorganism content of wine must be expressed in cells per mL, in scientific notation to one decimal place. If the content is lower than 1.0 cells per mL, the result must be presented as "<1.0 cells per/mL".

(See annexes on following pages)

Bibliography

ISO 4833:2003. Microbiology of food and animal feeding stuffs – Horizontal medium for the enumeration of microorganisms – Colony count technique at 30°C.
ISO 7218:2007 - Microbiology of food and animal feeding stuff - General rules for microbiological examinations.
ISO 7667:1983. Microbiology - Standard layout for methods of microbiological examination.
Pallman, C., J. B. Brown, T. L. Olineka, L. Cocolin, D. A. Mills and L. F. Bisson. 2001. Use of WL medium to profile native flora fermentations. American Journal of Enology and Viticulture 52:198-203;
A. Cavazza, M. S. Grando, C. Zini, 1992. Rilevazione della flora microbica di mosti e vini. Vignevini, 9-1992 17-20.- ANDREWS, W. et MESSER, J. (1990). Microbiological Methods. in : AOAC Official Methods of Analysis, 15th edition, 1, 425-497, Association of Analytical Chemist, Washington.
BIDAN, P. (1992). Analyses Microbiologiques du Vin. F.V. O.I.V. nº 910, Paris.
BOURGEOIS, C.M. et LEVEAU, J.Y. (1991). Techniques d'analyse et de contrôle dans les industries agro alimentaires, 2ème édition, 3. Le Contrôle Microbiologique Lavoisier, Tec. & Doc., APRIA Ed. Paris.
CARR, J. G. (1959). Acetic acid bacteria in ciders. Ann. Rep. Long Ashton Res. Sta., 160.
DE MAN, J. C. (1975). The probability of most probable number. European Journal of Applied Microbiology, 1, 67-78.
LAFON-LAFOURCADE, S. et al. (1980). Quelques observations sur la formation d'acide acétique par les bactéries lactiques. Conn. Vigne Vin, 14, 3, 183-194.
MAUGENET, J. (1962). Les Acétobacter du cidre. Identification de quelques souches. An. Technol. Agric., 11, 1, 45-53.
PLARIDIS et LAFON-LAFOURCADE, S. (1983). Contrôle microbiologique des vins. Bull. O.I.V., 618, 433-437, Paris.
RIBÉREAU-GAYON, J. et PEYNAUD, E. (2004). Traité d'Oenologie, Tome 2, Librairie Polytechnique CH. Béranger, Paris et Liège.
Standard Methods for the Examination of Water and Waste Water (1976). 14th edition, American Public Health Association, Incorporated, New York.
Standard Methods for the Examination of Water and Waste Water (1985). 16th edition, American Public Health Association, DC 20005, Washington.
VAZ OLIVEIRA, M., BARROS, P. et LOUREIRO, V. (1995). Analyse microbiologique du vin. Technique des tubes multiples pour l'énumération de micro-organismes dans les vins - "Nombre le plus probable" (NPP), F.V. O.I.V. nº 987, Paris.
VAZ OLIVEIRA, M. et LOUREIRO, V. (1993). L'énumération de micro-organismes dans les vins ayant un indice de colmatage élevé, Compte rendu des travaux du groupe d'experts "Microbiologie du Vin" de l'O.I.V., 12ème session, annexe 2, Paris.
VAZ OLIVEIRA, M. et LOUREIRO, V. (1993). L'énumération de micro-organismes dans les vins ayant un indice de colmatage élevé, 2ème partie, Doc. Travail du groupe d'experts "Microbiologie du Vin" de l'O.I.V., 13ème session, Paris.

Appendix 2 : Preparation of dilutions and inoculatons

Appendix 3 Table A

"Most Probable Number" (MPN) for 1 mL sample utilizing 3 tubes

with 1 mL, 0.1 mL et 0.01 mL

	Positive tubes					Positive tubes				Positive tubes
1 mL			0,1 mL	0,01 mL	MPN 1 mL	1 mL	0,1 mL	0,01 mL	MPN 1 mL	1 mL	0.1 mL	0,01 mL	MPN 1 mL
		0	0	0	0,0	2	0	2	2,0	1	1	1	7,5
		0	0	1	0,3	2	1	0	1,5	3	1	2	11,5
		0	1	0	0,3	2	1	1	2,0	3	1	3	16,0
		0	1	1	0,6	2	1	2	3,0	3	2	0	9,5
		0	2	0	0,6	2	2	0	2,0	3	2	1	15,0
		1	0	0	0,4	2	2	1	3,0	3	2	2	20,0
		1	0	1	0,7	2	2	2	3,5	3	2	3	30,0
		1	0	2	1,1	2	2	3	4,0	3	3	0	25,0
		1	1	0	0,7	2	3	0	3,0	3	3	1	45,0
		1	1	1	1,1	2	3	1	3,5	3	3	2	110,0
		1	2	0	1,1	2	3	2	4,0	3	3	3	>140,0
		1	2	1	1,5	3	0	0	2,5
		1	3	0	1,6	3	0	1	4,0
		2	0	0	0,9	3	0	2	6,5
		2	0	1	1,4	3	1	0	4,5

Adapted from the “ Standard Methods for the Examination of Water and Waste Water ” (1976)

Appendix 4

Diluents:

Diluents are indicated by way of example. The water to be used must be distilled, double distilled or deionized, with no traces of metals, inhibitors or other anti- microbial substances.

Physiological water

Preparation: Weigh 8.5g of sodium chloride in a 1000 mL calibrated flask. After it has dissolved in the water, adjust the reference volume. Mix thoroughly. Filter. Distribute 9 mL in the test tubes. Stop with carded cotton and autoclave for 20 min at 121°C.

Ringer's solution 1/4

Preparation: Weigh 2.250g of sodium chloride, 0.105g of potassium chloride, 0.120g of calcium chloride (CaCl2.6H2O) and 0,050g of sodium hydrogen carbonate in a 1000 mL calibrated flask. After it has dissolved in water, make up to the mark. Mix thoroughly. Distribute 9 mL in the test tubes. Stop with carded cotton and autoclave for 15 min at 121°C. (This solution is available commercially)

Peptone water

Preparation: Weigh 1g of peptone in a 1000 mL calibrated flask. After it has dissolved in the water, adjust the reference volume. Mix thoroughly. Distribute 9 mL in the test tubes. Stop with carded cotton and autoclave for 20 min at 121°C.

Appendix 5

Culture media

Culture media and antimicrobials are indicated by way of example.

The water to be used must be distilled, double distilled or deionized with no traces of metals, inhibitors or other antimicrobial substances.

Solid culture media

If not otherwise stated, pH of all media should be adjusted to pH 5.5 -6.0

Media for yeast count

1.1. YM

Glucose: 50 g

Peptone: 5 g

Yeast extract: 3 g

Malt extract: 3 g

Agar-agar: 20 g

Water: up to 1000 ml

If necessary add 100 mg chloramphenicol to suppress bacterial growth and 150 mg biphenyl to suppress mould growth.

1.2. YEPD

Glucose: 20 g

Peptone: 20 g

Yeast extract: 10 g

Agar-agar: 20 g

Water: up to: 1000 ml

If necessary add 100 mg chloramphenicol to suppress bacterial growth and 150 mg biphenyl to suppress mould growth.

1.3. WL Nutrient Agar

Glucose: 50 g

Peptone: 5 g

Yeast extract: 4 g

Potassium phosphate monobasic ():0.55 g

Potassium chloride (KCl): 0.425 g

Calcium chloride (Ca):0.125 g

Magnesium sulphate (Mg): 0.125 g

Ferric chloride (Fe):0.0025 g

Manganese sulphite (Mn):0.0025 g

Bromcresol green: 0.022 g

Agar bacteriological: 12 g

Water: up to: 1000 ml

pH: 5.5

WL Differential agar is made by adding 4 mg/l cycloheximide to WL Nutrient Agar.

If necessary add 100 mg chloramphenicol to suppress bacterial growth.

1.4. Lysine Agar ASBC

Solution A:

Yeast Carbon Bass: 2.35 g

Water: up to: 100 ml

Sterilize by membrane filtration.

Solution B:

Lysine-HCl: 0.5 g

Agar agar: 4 g

Water: up to: 100 ml

Sterilize in 20 min. at 121C.

If necessary add 100 mg chloramphenicol to suppress bacterial growth.

Media for lactic acid bacteria count

2.1. M.R.S. + tomato (or apple) juice.

Glucose: 20 g

Peptone: 10 g

Beef extract: 8 g

Yeast extract: 4 g

Potassium phosphate, dibasic (): 2 g

Sodium acetate 3O: 5 g

Ammonium citrate: 2 g

Magnesium sulphate 6O: 0.2 g

Manganese sulphate 4O: 0.05 g

"Tween 80": 1 ml

Agar agar: 12 g

Tomato (or apple, or grape) juice: 200 ml

Water up to : 1000 ml

Add 100mg / L natamycin (pimaricin) to inhibit the growth of yeasts, after autoclaving, just before use.

2.2. Tomato Juice Agar

Tomato juice (dry extract from 400 ml): 20 g

Peptone: 10 g

Peptonized milk: 10 g

Agar-agar: 14 g

Water : 1000 ml

pH: 6.1

Add 100mg / L natamycin (pimaricin) to inhibit the growth of yeasts, after autoclaving, just before use.

2.3. Modified ATB medium, or Oenococcus oeni medium (formerly Leuconostoc oenos medium).

Solution A:

Glucose: 10 g

Yeast extract : 5 g

Peptone : 10 g

Magnesium sulphate: 0.2 g

Manganese sulphate: 0.050 g

Tomato juice (or apple juice or grape juice): 250 ml

Agar agar: 12 g

Water: 750 ml

Sterilize by autoclaving 20 min. at 121C.

Solution B:

Cysteine HCl: 1 g

Water: up to: 100 ml

pH : 4.8

Sterilize by membrane filtration.

Add 100mg / L natamycin (pimaricin) to inhibit the growth of yeasts, just before use.

Add 1 ml of solution B to 20 ml of solution A at the moment of use

2.4. Lafon-Lafourcade medium

Glucose: 20 g

Yeast extract: 5 g

Beef extract: 10 g

Peptone: 10 g

Sodium acetate: 5 g

Tri-ammonium citrate: 2 g

Magnesium sulphate 6O: 0.2 g

Manganese sulphate  4O 0.05 g

"Tween 80": 1 ml

Agar-agar: 20 g

Water: up to: 1000 ml

pH: 5.4

Add 100mg / L natamycin (pimaricin) to inhibit the growth of yeasts, after autoclaving, just before use.

2.5. Dubois medium (Medium 104)

Tomato juice: 250 ml

Yeast extract: 5 g

Peptone: 5 g

Malic acid: 3 g

Magnesium sulphate  6O:0.05 g

Manganese sulphate  4O: 0.05 g

Agar-agar: 20 g

Water: up to: 1000 ml

pH: 4.8

Add 100mg / L natamycin (pimaricin) to inhibit the growth of yeasts, after autoclaving, just before use.

2.6. MTb.

Glucose: 15 g

Lab-Lemco Powder (Oxoid): 8 g

Hydrolyzed casein: 1 g

Yeast extract: 5 g

Tomato juice: 20 ml

Sodium acetate: 3 g

Ammonium citrate: 2 g

Malic acid: 6 g

Magnesium sulphate: 0.2 g

Manganese sulphate: 0.035 g

"Tween 80": 1 mg

TC Vitamins Minimal Eagle, 100x (BD-Difco) 10 ml*

pH (con KOH): 5.0

Water up to: 1000 ml

* add after sterilization.

Add 100mg / L natamycin (pimaricin) to inhibit the growth of yeasts, after autoclaving, just before use.

Media for acetic acid bacteria count

3.1. GYC

Glucose: 50 g

Yeast extract: 10 g

Calcium carbonate (Ca): 30 g

Agar: 25 g

Water: up to: 1000 ml

Add 100mg / L natamycin (pimaricin) to inhibit the growth of yeasts, and 12.5 mg/L of penicillin to eradicate the growth of lactic acid bacteria, after autoclaving, just before use.

3.2. Medium G2

Yeast extract: 1.2 g

Ammonium phosphate: 2 g

Apple juicE: 500 ml

Agar: 20 g

Water: up to: 1000 ml

pH: 5.0

Add 100mg / L natamycin (pimaricin) to inhibit the growth of yeasts, and 12.5 mg/L of penicillin to eradicate the growth of lactic acid bacteria after autoclaving, just before use.

3.3. Kneifel medium

Yeast extract: 30 g

EthanoL: 20 ml*

Agar: 20 g

Bromocresol green 2.2%: 1mL

Water: up to1000 ml

* to be added after sterilization.

Add 100mg / L natamycin (pimaricin) to inhibit the growth of yeasts, and 12.5 mg/L of penicillin to eradicate the growth of lactic acid bacteria after autoclaving, just before use.

Blue colonies: Acetobacter, Gluconacetobacter

Green colonies: Gluconobacter

Media for mould count

4.1. Czapek-Dox, Modified

Sucrose: 30 g

NaNO₃: 3 g

K₂HPO₄: 1 g

MgSO₄: 0.5 g

KCl: 0.5 g

FeSO₄ : 0.01g

Agar 15 g

Final pH (at 25°C) 7.3 0.2

Add 10 mg/l cycloheximide to suppress yeast growth (cycloheximide-resistant yeast growth is usually slower than mould growth).

Note: This medium allows the growth only of nitrate-growing moulds.

Add tetracycline (100 mg/l) and streptomycin (100 mg/l) to suppress growth of bacteria.

4.2. Dichloran Rose Bengal Chloramphenicol Agar (DRBC Agar)

Glucose: 10 g

Peptone : 5 g

KH₂PO₄: 1 g

MgSO₄ :0.5 g

Rose Bengal: 0.025 g

Dichloran (2,6 dichloro-4-nitroaniline) : 0.002g

Chloramphenicol solution (0.1 g/10ml)*: 10 ml

Agar : 15 g

Final pH (at 25°C) 5.6 0.2

* To be added after sterilization.

4.3. Malt Extract Agar (MEA)

Glucose: 20 g

Malt extract : 20 g

Peptone: 5 g

Agar : 15 g

Final pH (at 25°C) 5.5 0.2

Add tetracycline (100 mg/l) and streptomycin (100 mg/l) to suppress growth of bacteria.

Liquid culture media
1. For yeasts

YEPD medium (Yeast Extract, Peptone, Dextrose) + chloramphenicol

Preparation: Weigh 10.0g of yeast extract (Difco or equivalent), 20g of peptone, 20g of glucose and 100 mg of chloramphenicol. Dissolve, make up to 1000 mL volume with water and mix.

Distribute 5 mL portions of this medium in the test tubes and autoclave for 15 minutes at 121°C.

5.2. For lactic bacteria

MTJ medium (50% MRS medium "Lactobacilli Man Rogosa and Sharpe

Broth" + 50% TJB medium "Tomato Juice Broth") + actidione

Preparation: Weigh 27.5g of MRS "Lactobacilli Man Rogosa and Sharpe Broth" (Difco or equivalent). Add 500 mL of water, heat to boiling to permit complete dissolution and add 20.5g of TJB "Tomato Juice Broth" (Difco or equivalent). Add 50g of actidione. Dissolve with water in order to obtain 1000 mL of solution having first corrected the pH to 5 with 1N hydrochloric acid and mix.

Distribute 10 mL portions of this medium [3)] in the tubes and autoclave for 15 minutes at 121°C.

Appendix 6: Recognition of specific microorganisms

6.1. Yeast colony recognition on WL Nutrient Agar.

The use of this medium does not want to be a method to identify species, but can offer to non-specialized laboratories a quick and cheap way to predict the genus of viable and culturable yeasts. After 4-days incubation evaluate the colony morphology as follows (Pallman, C., J. B. Brown, T. L. Olineka, L. Cocolin, D. A. Mills and L. F. Bisson. 2001. Use of WL medium to profile native flora fermentations. American Journal of Enology and Viticulture 52:198-203; A. Cavazza, M. S. Grando, C. Zini, 1992. Rilevazione della flora microbica di mosti e vini. Vignevini, 9-1992 17-20):

Saccharomyces spp.: Colonies grow well in 4 days on WL Nutrient Agar giving circular cream-coloured to pale greenish colonies. Different colour shades do not necessary indicate the presence of different strains, but the presence of petite mutants; colonies are umbonated, smooth and dull surface, the consistency is butyrous. It doesn’t grow on Lysine Agar.

Torulaspora spp.: the colonies are similar to those of Saccharomyces spp. It grows on Lysine Agar.

Hanseniaspora spp. (Kloeckera spp.) Grows on WL Nutrient Agar in 4 days, giving deep green flat, smooth and butyrous colonies. It grows on Lysine Agar and on WL Differential Agar.

Candida stellata Grows on WL Nutrient Agar in 4 days, giving pea-green, smooth and butyrous colonies, becoming darker in the centre with the age. It grows on Lysine Agar.

Saccharomycodes spp.Grows on WL Nutrient Agar in 4 days, giving light green, smooth and butyrous convex colonies. It grows on Lysine Agar, not on WL differential agar.

Note: its cells, viewed under the microscope, are very large (up to 25 m).

Schizosaccharomyces pombe Grows on WL Nutrient Agar in 4 days, giving deep green pinpoint size, smooth colonies. It grows on Lysine Agar.

Note: its cells, under the microscope are easily recognised because of typical scission division.

Rhodotorula spp. Grows on WL Nutrient Agar in 4 days, giving deep pink, smooth and mucous surface and butyrous colonies. It grows on Lysine Agar.

Metschnikowia spp. Grows on WL Nutrient Agar in 4 days, giving clear, smooth and butyrous little colonies. A reddish pigment diffuses in the medium below the colonies. It grows on Lysine Agar.

Pichia membranifaciens Grows on WL Nutrient Agar in 4 days, giving greyish- or bluish-shaded rough and powdery convex colonies. It grows on Lysine Agar.

Pichia anomala (formerly Hansenula anomala) grows on WL Nutrient Agar in 4 days, giving cream-colored or bluish colonies, distinctly bluish after 8 days. Colonies are circular, the surface is smooth and the consistency is butyrous, but sometimes clearly mucous. It grows on Lysine Agar.

Dekkera spp. or Brettanomyces spp. Grows on WL Nutrient Agar in 8 days, giving small dome-shaped, cream-coloured, smooth and butyrous colonies. It produces high amounts of acetic acid, clearly perceivable by smell that turns the medium to yellow. It grows on Lysine Agar and on WL Differential Agar. The growth on this last medium makes it possible to distinguish it from Zygosaccharomyces bailii.

Note: a confirmation is possible with microscopical examination: Dekkera has small cells, some of them have a typical ogival shape.

Zygosaccharomyces bailii Grows on WL Nutrient Agar in 4 days, giving small circular cream-coloured, smooth and butyrous colonies. It grows on Lysine Agar but not on WL Differential Agar. A yellowish halo is often present around young colonies.

Note: when grown on bottled wine it produces brown 0,5-1 mm clusters. Its cells do not have ogival shape.

Acetic acid bacteria grow on WL Nutrient Agar with small to pinpoint-size deeply green and brilliant colonies that are strongly positive to catalase test. (Note – This medium is not suitable for their count).

Lactic Acid Bacteria grow on WL Nutrient Agar in 10 days with pinpoint size clear catalase-negative colonies. (Note – This medium is not suitable for their count).

6.2. Lactic Acid Bacteria colony recognition.

LAB colonies are translucent and range in size from a pinpoint to a few mm in diameter. They are gram-positive and catalase-negative. Oenococcus oeni grow in short chains, pediococci form tetrads and diplococci, lactobacilli form long or short bacilli.

6.3. Acetic Acid Bacteria colony recognition.

AAB colonies are catalase positive and gram-negative, and are strong acid-producers: this can be seen by a clear zone around their colonies in media containing calcium carbonate or by a different colour if the medium contains a pH indicator. Their cells are cocci or bacilli, generally a little larger than LAB.

[3)] The 10 mL volume is used instead of the 5 mL volume as with yeasts, due to the greater sensitivity of lactic bacteria to oxygen.

Detection of preservatives and fermentation inihibitors (Fermentability Test) (Type-IV)

OIV-MA-AS4-02A Detection of preservatives and fermentation inhibitors

Type IV method

Fermentability Test

1.1. Objective

To show without specifying their nature, the possible presence of one or several substances which act as fermentation inhibitors in wine.

1.2. Principle

The wine, whose free sulfur dioxide has been bound by addition of an aqueous solution of acetaldehyde, is brought to 10% (v/v) alcohol. Glucose is added in order for the sugar concentration to be between 20 and 50 g/L in the nutrient solutions.

After inoculation with a yeast strain resistant to alcohol, the fermentation is followed by weighing the quantity of carbon dioxide released.

The fermentation rate is compared to that of an authentic natural wine similar in make up to the wine analyzed, and also to that of the test wine whose pH has been adjusted to 6 (the majority of the mineral and organic acids are not active in fermentation at this pH). These two reference wines are inoculated in the same manner as the test wine.

1.3. Apparatus

90 mL flask sealed with a rubber stopper with a hole into which is placed a narrow tube tapered at the uppermost portion.

1.4. Reagents and media

1.4.1. Aqueous acetaldehyde solution:

Solution prepared from acetaldehyde obtained by distillation of metaldehyde or paraldehyde, in the presence of sulfuric acid, and standardized by the method using sodium sulfite. Adjust the concentration of the solution to 6.9 g/L.

1 mL of this solution fixes 10 mg of sulfur dioxide.

1.4.2. Nutrient Solutions:

Ammonium Sulfate, :25 g/L

Asparagine 20 g/L

These solutions must be stored in the refrigerator.

1.4.3. Culture Medium:

Solid medium: malt agar.

Powdered malt 3 g

Glucose 10 g

Pancreatic peptone 5 g

Powdered yeast extract 3 g

Agar 20 g

Water 1 L

pH 6

Sterilize for 20 min. at 118 °C.

This mixture exists in a commercial prepared form.

Liquid medium (an option):

Divide the grape juice containing 170 to 200 g/L of sugar, in tubes stoppered with cotton, at a rate of 10 mL per tube; sterilize in a water bath at 100 °C for 15 min.
Liquid malt: same medium as the solid medium, but without agar.
1. Culture and maintenance of the Saccharomyces bayanus strain and preparation of the yeast.

a) Culture and maintenance of the strain on solid medium: From a collection strain, inoculate in lines (streak) onto tubes of solid medium. These tubes are put in an incubator at 25°C until the culture is very visible (about 3 days); the tubes can be stored in the refrigerator. This is sufficient for 6 months.

b) Preparation of the yeast:

One of the tubes of the liquid medium is inoculated in accordance with proper microbiological techniques from the strain cultivated on solid medium; after growth (24 to 48 h), repeat 2 times successively into the same medium enriched with 10% alcohol (v/v), to acclimate the strain.

The second culture when actively fermenting will contain about 50 million yeast per milliliter. This culture will serve to inoculate the wine to be studied. Perform a count and inoculate at a rate of yeast/mL.

1.5. Procedure

Preparation of the wine:

100 mL of wine is treated with the necessary quantity of acetaldehyde calculated in accordance with the amount of free sulfur dioxide (44 mg of aldehyde binds 64 mg of sulfur dioxide). Wait 24 hours and check that the wine contains less 20 mg free sulfur dioxide per liter.

If the alcoholic strength is greater than 10% (v/v), the wine should be diluted with one of the solutions of glucose and water in amounts calculated to result in a sugar concentration between 20 and 50 g/L, and to reduce the strength to about 10% (v/v). For wines containing less than 10% vol., add solid glucose to bring without dilution the amount of sugar between these values, so the fermentation rate is not altered by the amount of sugar.

Fermentability test:

In a 90 mL flask, place 60 mL of wine prepared as above, 2.4 mL of ammonium sulfate solution and 2.4 mL of asparagine solution. Inoculate with 3 drops of a 3 day old culture of Saccharomyces bayanus, to obtain an initial population close to 10⁵ yeast/mL. Install the stopper with the pointed tube, weigh the assembly to the nearest 10 mg and place in an oven at 25°C.

Weigh daily for at least 8 days.

Run each time concurrently, a wine of comparable make up and origin which does not contain any preservative along with the test wine which has been adjusted to pH 6.

A flask of non-inoculated wine indicates loss by evaporation.

1.6. Interpretation

In most cases, the fermentation begins within 48 hours and the daily liberation of gas is greatest between the 3rd and the 5th day.

One can confirm the presence of a fermentation inhibitor only in the following conditions:

a) If the fermentation does not begin or is delayed at least 2 days compared to one of the 2 controls. When the delay is brief, it is difficult to ascertain the presence because there may be "false positive" results, since certain natural sweet wines sometimes behave as if they contained traces of inhibitors (in particular sweet wines made from grapes having noble rot).

b) If the maximum daily release has not taken place between the 3rd and 5th day, but after the 7th day, this release must be greater than or equal to 50 mg for 60 mL of wine.

Plotting the fermentation curve and the curve of daily release of as a function of time can facilitate the interpretation in a difficult case.

Detection of preservatives and fermentation inihibitors (Detection of the following acids: sorbic, benzoic, p-chlorobenzoic, salicylic, phydroxybenzoic and its esters) (Type-IV)

OIV-MA-AS4-02B Detection of preservatives and fermentation inhibitors

Type IV method

Detection of the following acids: sorbic, benzoic, p-chlorobenzoic, salicylic, phydroxybenzoic and its esters

1.1. Thin layer chromatography

1.1.1. Principle

The preservatives are extracted with ether from the previously acidified wine. After separation by thin layer chromatography with polyamide powder, they are located and characterized by examining the chromatogram under ultraviolet light.

1.1.2. Apparatus

Chromatography bath.

20 x 20 cm glass plates.

Preparation of the plates - Mix thoroughly 12 g of dry polyamide powder with 0.3 g fluorescent indicator; add, while stirring, 60 mL of methanol; spread on plates to a thickness of 0.3 mm. Dry at normal temperature.

Note:Commercially prepared plates can be used.

1.1.3. Reagents

Diethyl ether

Methanol

Ethanol, 96% (v/v).

Sulfuric acid diluted to 20% (v/v)

Anhydrous sodium sulfate

Polyamide powder for chromatography (e.g., Macherey-Nagel or Merck).

Fluorescent indicator (F₂₅₄ Merck or equivalent).

Solvent:

n-Pentane :10 vol.

n-Hexane :10 vol.

Glacial acetic acid :3 vol.

Standard solutions:

Prepare standard solutions containing 0.1 g/100 mL of 96% ethanol (v/v) of the following acids: sorbic, p-chlorobenzoic, salicylic, p-hydroxybenzoic and its esters.
Prepare a solution of 0.2 g benzoic acid per 100 mL of 96% ethanol (v/v).
1. Procedure

Place 50 mL of wine in a separatory funnel; acidify with dilute 20% sulfuric acid (1.1.3.4), and extract 3 times using 20 mL diethyl ether (1.1.3.1) per extraction. Combine the washed solutions in a separatory funnel and wash with a few milliliters of distilled water. Dry the ether with the anhydrous sodium sulfate (1.1.3.2). Evaporate the ether dry using a 100°C water bath, or a rotary evaporator. If the evaporation is accomplished on a water bath, it is advisable to hasten the evaporation using a mild current of air until 2 or 3 milliliters remain, then finish the evaporation cold.

Dissolve the residue in 1 mL ethanol, deposit 3 to 5 μL of this solution on the polyamide plate, as well as 3 to 5 μL of the various preservative standard alcoholic solutions (1.1.3.9). Place the plate in a chromatography tank, and saturate with solvent vapors. Let the solvent migrate to a height of about 15 cm, which takes from 1.5 to 2.5 hours.

Remove the plate from the tank and allow to dry at normal temperature. Examine in ultraviolet light, at a wavelength of 254 nm. The preservatives appear from the bottom of the plate upward in the following order: p-hydroxybenzoic acid, esters of p-hydroxybenzoic, salicylic acid, p-chlorobenzoic acid, benzoic acid, sorbic acid.

With the exception of salicylic acid, which has a light blue fluorescence, other preservatives give dark spots on a fluorescent yellow-green background.

Sensitivity - This technique allows determination of the following minimum quantities of the miscellaneous preservatives expressed in milligrams per liter:

Salicylic acid 3

Sorbic acid 5

Esters of p-hydroxybenzoic acid 5

p-hydroxybenzoic acid 5-10

p-chlorobenzoic acid 5-10

Benzoic acid 20

1.2. High performance liquid chromatography

1.2.1. Procedure

The method is performed directly on the wine, without sample preparation. It is necessary to dilute red wines before injecting them in order to preserve the column.

Using this method, the detection threshold of preservatives in the solution analyzed is about 1 mg/L.

1.2.2. Operating conditions

Conditions which are appropriate are the following:

For the determination of sorbic and benzoic acid

Proceed according to the sorbic, benzoic, salicylic acid assay method in wines by high performance liquid chromatography (AS313-20-SOBESA) provided in the Compendium

B. For the determination of p-chlorobenzoic acid, p-hydroxybenzoic acid and its esters

Column: see A

Mobile phase:

Solution of ammonium acetate, 0.01 M + methanol (60 : 40)

pH: 4.5 - 4.6

Flow rate: see A

Injected volume: see A

Detector: UV, 254 nm

Temperature: see A

Bibliography

Junge Ch., Zeits. Unters. Lebensmit., 1967, 133, 319

Detection of preservatives and fermentation inihibitors (Detection of the monohalogen derivatives of acetic acid) (Type-IV)

OIV-MA-AS4-02C Detection of preservatives and fermentation inhibitors

Type IV method

Detection of the monohalogen derivatives of acetic acid

1.1. Principle

The monohalogen derivatives of acetic acid are extracted with ether from acidified wine. The ether is then extracted using a 0.5 M sodium hydroxide solution. The extraction solution must have the alkalinity maintained between 0.4 and 0.6 M. After the addition of thiosalicylic acid, the synthesis of the thioindigo is implemented by the following steps:

a) Condensation of the monohalogen derivative with thiosalicylic acid and formation of ortho-carboxylic phenylthioglycolic acid;

b) Cyclization of the acid formed in a heated alkaline medium, with the formation of thioindoxyl;

c) Oxidation of the thioindoxyl with potassium ferricyanide in an alkaline medium with formation of thioindigo, soluble in chloroform, in which it gives a red color.

1.2. Apparatus

Water bath at 100°C.

Mechanical stirrer.

Oven with a temperature of 200 2°C.

1.3. Reagents

Diethyl ether.

Hydrochloric acid solution diluted to 1/3 (v/v). Mix one part pure hydrochloric acid, ρ₂₀ = 1.19 g/mL, with 2 parts of distilled water.

Anhydrous sodium sulfate.

Thiosalicylic acid solution: thiosalicylic acid 3 g in 100 mL sodium hydroxide solution, 1.5 M.

Sodium hydroxide solution, 0.5 M

Potassium ferricyanide solution containing 2 g of per 100 mL of water.

Chloroform.

1.4. Procedure

Place 100 mL of test wine in an extraction flask with a ground glass stopper; add 2 mL hydrochloric acid (1.3.2) and 100 mL diethyl ether (1.3.1). Shake the contents vigorously for a few seconds by hand, then for 1 h with a mechanical stirrer (1.2.2). Transfer to a separating funnel, allow to separate and recover the ether layer.

Shake the ether extract with 8 to 10 g of anhydrous sodium sulfate (1.3.3) for a few seconds.

Transfer the extract to the separating funnel, add 10 mL sodium hydroxide solution, 0.5 M (1.3.5); shake for 1 min. Allow to settle.

Remove 0.5 mL of the alkaline extract and check, by titration with sulfuric acid, 0.05 M, so that the strength falls between 0.4 and 0.6 M. Transfer the alkaline extract contained in the separating funnel into a test tube containing 1 mL of thiosalicylic acid solution. Adjust, if necessary the strength of the alkaline extract in order to bring it to the limits indicated, using a stronger sodium hydroxide solution of known strength. Shake the contents of the test tube for 30 seconds and transfer to an evaporating dish.

Place the dish on a water bath at 100°C blowing its surface with a current of cold air. Maintain the dish on the water bath at 100°C for exactly 1 hour; the residue may become practically dry in a shorter amount of time. If a crust forms on the surface of the residue during the evaporation, it is advisable to break or grind it up with a thin glass rod to facilitate the evaporation.

Place the dish in an oven maintained at 200 2°C for exactly 30 minutes. After cooling, recover the contents of the dish with 4 mL of water; transfer into a separation funnel, add to the dish 3 mL of potassium ferricyanide solution to fully dissolve any remaining residue and add to the separating funnel. Shake for 30 seconds to facilitate oxidation. Add 5 mL chloroform, mix using 3 to 4 inversions. Allow to separate.

A pink or red color (according to the quantity of thioindigo formed) indicates the presence of monohalogen derivatives of acetic acid.

Sensitivity - The method allows detection of 1.5 to 2 mg monochloroacetic acid per liter of wine and corresponding quantities of the other derived monohalogens. Since the yield of miscellaneous extractions is not quantitative, this method cannot be used for determining the amount of these monohalogen derivatives in the wines.

Bibliography

Friedlander, Ber. Deutsch. Chem. Gesell., 1906, 39, 1062.
Ramsey L.L., Patterson W.I., J. Ass. Off. Agr. Chem., 1951, 34, 827.
Peronnet M., Rocques S., Ann. Fals. Fraudes, 1953, 21-23.
Traité de chimie organique, edited by V. Grignard, 1942, 19, 565-566.
Official Methods of Analysis of the Association of Official Analytical Chemists, 11th édition, publiée par l'Association of Official Analytical Chemists, Washington, 1970, 340-341.
TERCERO C., F.V., O.I.V., 1967, n° 224.

Detection of preservatives and fermentation inihibitors (determination of ethyl pyrocarbonate) (Type-IV)

OIV-MA-AS4-02D Detection of preservatives and fermentation inhibitors

Type IV method

Examination and determination of ethyl pyrocarbonate (diethyl dicarbonate)

1.1. Principle

The diethyl carbonate formed by degradation of ethyl pyrocarbonate (diethyl ester of pyrocarbonic acid) in the presence of ethanol is extracted from wine using carbon disulfide and the quantity determined by gas chromatography. Either of the procedures described below may be used.

1.2. Apparatus

1.2.1. Gas chromatography with flame ionization detector.

1.2.2. Columns:

Capillary column coated with Carbowax 1540
Column length: 15.24 m
Inside diameter: 0.51 mm
Polypropyleneglycol on Celite 545 (15:100), 60‑100 mesh
Column length: 2 m
Interior diameter: 3 mm
1. Reagents
  1. Anhydrous sodium sulfate
  2. Carbon disulfide

The carbon disulfide must contain no impurities in the critical retention zone (5 to 7 min.) for maximum sensitivity in accordance with the conditions of gas chromatography as indicated in paragraph 1.4.2.

1.4. Procedure

1.4.1. Use of the capillary column.

Place 100 mL wine in a 250 mL separating funnel with 1 mL of carbon disulfide (1.3.2). Mix vigorously for 1 min. The carbon disulfide phase separated is rapidly centrifuged, then dried with anhydrous sodium sulfate (1.3.1).

Inject 10 μl of the clear liquid supernatant into the chromatograph.

Chromatography conditions:

Detector gases:

hydrogen: 37 mL/min.
air: 250 mL/min.

Gas flow:

nitrogen: 40 mL/min.
A 1/10 splitter sends to the detector the gas mixture with a flow rate of 3 to 5 mL/min.
Temperature:
injector: 150 °C; oven: 80 °C; detector: 150 °C

Detection limits:

0.05 mg/L of wine

1.4.2. Use of the column for polypropyleneglycol.

Add 20 mL of wine and 1 mL of carbon disulfide (1.3.2) into a conical centrifuge tube with a stopper. Agitate vigorously for 5 minutes, then centrifuge for 5 minutes applying a centrifugal force of 1000 to 1200 g. The liquid supernatant produced is aspirated by a thin-tipped pipette; the carbon disulfide phase is dried with a small quantity of anhydrous sodium sulfate, added while stirring with a glass rod. Inject 1 µL of the clear liquid into the gas chromatograph.

Chromatography conditions.

Detector gas:

hydrogen: 35 mL/min.
air: 275 mL/min.

Carrier gas flow:

nitrogen: 25 mL/min.

Temperature:

injector: 240 °C
oven: 100 °C
detector: 240 °C

Sensitivity range:

12 x 10-11 A to 3 x 10-11 A

Chart speed:

1 cm/min.

Detection limit:

0.10 - 0.05 mg/L of wine

Under these exact conditions, diethyl carbonate displays a retention time of about 6 min.

The calibration of the apparatus is carried out using solutions of 0.01 and 0.05% (m/v) diethyl carbonate in carbon disulfide (1.3.2).

1.5. Calculation

Quantitative determination of diethyl carbonate is carried out preferably using the internal standard method, referring to the peaks of the iso-butyl alcohol or iso-amyl alcohol which are close to that of diethyl carbonate.

Prepare two samples of test wine: one of wine with 10 mL 10% ethanol (v/v) added, the other the same wine to which has been added 1 mg diethyl carbonate per liter using 10 mL of a 100 mg/L solution of diethyl carbonate in 10% ethanol (v/v).

Treat these two samples according to one or the other of the techniques above according to the column used.

Let:

S = the peak area of the diethyl carbonate in the spiked wine

= the peak area of the diethyl carbonate in the wine,

i = the peak area of internal standard in the wine,

I = the peak area of internal standard in the spiked wine .

The concentration of diethyl carbonate in mg/L of wine is:

In the case where standardization is carried out using a pure standard solution of diethyl carbonate, it is necessary to predetermine the yield of the extraction with carbon disulfide in accordance with the procedure utilized. This yield is expressed by the extraction factor F, with a decimal number less than or equal to 1 (yield 100%).

Let:

= the peak area of diethyl carbonate given by the wine,

= the peak area given by the injection of the same volume of a standard solution of diethyl carbonate of concentration C in mg/L,

= the volume of wine used in the extraction with carbon disulfide,

= the volume of carbon disulfide used for the extraction,

= the sensitivity for the recording of

The concentration of diethyl carbonate in mg/L of wine is:

If the concentration of the two solutions injected in the chromatograph is similar, the response is the same for the recording of Sx and of Se; the formula is simplified and becomes:

Bibliography

Kielhofer E., Wurdig G., Dtsch. Lebensmit. Rdsch., 1963, 59, 197-200 & 224-228.
Prillinger F., Weinberg u. Keller, 1967, 14, 5-15.
Reinhard C., Dtsch. Lebensmit. Rdsch., 1967, 5, 151-153.
Bandion F., Mitt. Klosterneuburg, Rebe u. Wein, 1969, 19, 37-39.

Detection of preservatives and fermentation inihibitors (Examination of dehydroacetic acid) (Type-IV)

OIV-MA-AS4-02E Detection of preservatives and fermentation inhibitors

Type IV method

Examination of dehydroacetic acid

1.1. Principle

Wine acidified with sulfuric acid is extracted with a mixture of equal parts of diethyl ether and petroleum ether. After evaporation of the solvent, the extract, recovered with a small quantity of 96% ethanol (v/v) is deposited on a thin layer of polyamide and silica gel with fluorescent indicator and subjected to the action of the mobile solvent (benzene-acetone-acetic acid). The dehydroacetic acid is identified and characterized by ultraviolet examination of the chromatogram.

1.2. Apparatus

1.2.1. Equipment for thin layer chromatography

1.2.2. Oven

1.2.3. Rotary evaporator

1.2.4. UV lamp 254 nm.

1.3. Reagents

1.3.1. Diethyl ether

1.3.2. Petroleum ether (boiling point  40 °C)

1.3.3. Methanol

1.3.4. Sulfuric acid, 20% (v/v)

1.3.5. Anhydrous sodium sulfate.

1.3.6. Ethanol, 96% (v/v).

1.3.7. Chromatographic separation layer: 10 g polyamide powder with fluorescent indicator(e.g. polyamide DC II UV₂₅₄ from Macherey-Nagel) mixed vigorously with 60 mL methanol. Add while stirring, 10 ml of water and 10ml of silica gel (with fluorescent indicator), e.g. Kiesselgel GF₂₅₄ Merck. Spread this mixture on 5 plates (200 x 200 mm) to a thickness of 0.25 mm. Dry the plates at room temperature for 30 minutes, then place in a 70°C oven for 10 min.

1.3.8. Migration solvent:

Crystallizable benzene :60 vol.

Acetone :3 vol.

Crystallizable acetic acid :1 vol.

1.3.9. Reference solutions:

Dehydroacetic acid and benzoic acid, 0.2%, in alcoholic solution.

Sorbic acid, p-chlorobenzoic acid, salicylic acid, p-hydroxybenzoic acid and its propyl, methyl and ethyl esters, 0.1 % (m/v), in alcoholic solution.

1.4. Procedure

Acidify 100 mL of wine using 10 mL of 20% sulfuric acid (1.3.3), then proceed to extract 3 times using 50 mL of a (50:50) diethyl ether-petroleum ether mixture for each extraction. Remove the clear aqueous phase leaving an aqueous emulsion and the ether phase. Mix again the remaining liquid in the separation flask composed of an emulsion and the ether phase. The remaining aqueous phase usually separates clearly from the ether phase. If there is any residual emulsion, it should be eliminated by the addition of a few drops of ethanol.

The diethyl ether-petroleum ether phases recovered are washed with 50 mL water, dried using sodium sulfate, then evaporated by rotary evaporator, at 30 - 35 °C. The residue is recovered with 1 mL of ethanol.

Deposit 20 μL of this solution on the starting line in a 2 cm wide band, or 10 μL in a circular spot. For a comparison standard, deposit 5 μL of each of the reference solutions described above. After the chromatography (ascending height of migration 15 cm, duration 1 hour 15 min. to 1 hour 45 min., at normal saturation of the chamber), the plate is dried at room temperature. Any dehydroacetic acid and other preservatives present show up under a UV lamp at 254 nm.

When the examination of the chromatogram has revealed the presence of para-chlorobenzoic acid, the propyl or methyl esters of para-hydroxybenzoic acid which are only partly separated by this method may be identified consequently on the extract above, following the method described in Examination of Sorbic, Benzoic, Parachlorobenzoic Acids, 2.1. Thin layer chromatography.

Bibliography

Haller H.E., Junge Ch., F.V., O.I.V., 1972, n° 397, Mitt. Bl. der Gd CH, Fachgruppe, Lebensmitt. u. gerichtl. Chem., 1971, 25, n° 5, 164-166.

Detection of preservatives and fermentation inihibitors (Sodium Azide by HPLC) (Type-IV)

OIV-MA-AS4-02F Detection of preservatives and fermentation inhibitors

Type IV method

Sodium Azide

1.1. Method by high performance liquid chromatography

1.1.1. Principle

Hydrazoic acid isolated in wine using double distillation is identified after derivatization with 3,5-dinitrobenzoyl chloride, by high performance liquid chromatography. Detection is carried out by ultraviolet absorption spectrophotometry at 240 nm.

1.1.2. Apparatus

1.1.2.1. Distillation apparatus (distillation apparatus for determination of alcoholic strength); the end of the condenser terminating in a tampered tube

1.1.2.2. 500 mL spherical flasks with ground glass necks

1.1.2.3. 10 mL flask with a ground glass stopper

Operating conditions:

Column: , 25 cm long.
Mobile Phase: acetonitrile-water (50:50)
Flow rate: 1 mL/min.
Volume injected: 20 μL
Detector: ultraviolet absorption spectrophotometer at 240 nm
Temperature: ambient
1. Reagents
  1. Sodium hydroxide, 5% (m/v).
  2. Sulfuric acid solution, 10% (m/v).
  3. Indicator reagent: methyl red 100 mg, and methylene blue 50 mg, 100 mL alcohol, 50% (v/v).
  4. Acetonitrile for chromatography.
  5. Derivatizing reagent: 3,5-dinitrobenzoyle chloride, 10% (m/v), in acetonitrile.
  6. Buffer solution of sodium acetate, pH 4.7: mix 1 volume of sodium acetate solution, Na, 1 M, with 1 volume acetic acid solution, 1 M.
  7. Sodium azide, Na.
2. Procedure
  1. Preparation of the sample.

Into a spherical flask with a ground glass neck, place 100 mL of wine, distill by plunging the end of the condenser in 10 mL of 5% sodium hydroxide solution (1.1.3), to which are added a few drops of reagent indicator. Distill until 40‑50 mL of distillate is recovered.

Transfer the distillate into another spherical flask (1.1.2.2), rinse the flask twice with 20 mL of water and add water to bring to 100 mL. To eliminate the ethanol, attach the flask to the distillation apparatus and eliminate about 50 mL of distillate (reduce the volume by half).

Cool the flask completely. Acidify with 10% sulfuric acid. Distill, recover the distillate into a 10 mL flask with a ground glass stopper containing 1 mL of water, and immerse in an iced bath. Stop the distillation when the total volume reaches 10 mL.

1.1.4.2. Derivitization

Mix 1 mL distillate (1.1.4.1), 0.5 mL of acetonitrile, 0.2 mL buffer solution and 30 μL of derivatizing reagent and stir vigorously; leave for five minutes.Chromatography

1.1.4.3. Inject 20 μL in accordance with the conditions specified, the hydrazoic acid derivative has a retention time of about 11 minutes. Detection limit: 0.01 mg/L.

Note : Sometimes another substance not derivatized can simulate hydrazoic acid. It is necessary to verify a positive result as follows: inject 20 μL of distillate directly; a disappearance of the peak indicates the presence of hydrazoic acid.

1.1.5. Calculation

To determine the concentration of sodium azide, compare the sample response to that of the standard solution after derivatization. Take into account the concentration factor 10 of the sample of wine at the time of analysis.

1.2. Colorimetric method

1.2.1. Principle

Hydrazoic acid, which is very volatile, is separated by double distillation, permitting the elimination of ethanol, acetic acid and sulfur dioxide. Then the amount is determined colorimetrically after forming a colored complex with ferric chloride (maximum absorbance at 465 nm).

1.2.2. Apparatus

1.2.2.1. Simple distillation apparatus, consisting of a 500 mL flask with a ground glass neck and a condenser ending in a pointed tube

1.2.2.2. Spectrophotometer with optical glass cells 1 cm path length

1.2.3. Reagents

1.2.3.1. Sodium hydroxide solution, 1 M

1.2.3.2. Sulfuric acid, 1 M

1.2.3.3. Hydrogen peroxide, 3% (v/v), whose strength must be adjusted just before use using a solution of potassium permanganate, 0.02 M; where p mL equals the volume which oxidizes 1 mL of the hydrogen peroxide solution, 3%

1.2.3.4. Ferric chloride solution at 20 g per liter of Fe III: (weigh 96.6 g of Fe.6, or more as this salt is very hygroscopic; control the concentration of Fe III of the solution and adjust if necessary to 20 0.5 g per liter)

1.2.3.5. Stock solution of sodium azide, NaN₃, at 1 g per liter in distilled water

1.2.3.6. 200 mg per liter sodium azide solution prepared by dilution of the solution at 1 g per liter

1.2.4. Procedure

a) Into a 500 mL flask with a ground glass neck, place 200 mL of wine, distill, recover the distillate in a 50 mL volumetric flask, containing 5 mL water, which is immersed in an iced bath. Stop the distillation when the total volume reaches about 50 mL.

b) Transfer quantitatively the distillate into another 500 mL flask with a stopper and rinse the 50 mL flask twice with 20 mL of water.

Neutralize using 1 M sodium hydroxide solution (1.2.3.1) (using pH indicator paper).

Acidify using 10 mL 1 M sulfuric acid (1.2.3.2), mix, then oxidize the sulfur dioxide by adding 3% hydrogen peroxide solution (1.2.3.3.).

If the wine contains S mg per liter of sulfur dioxide, and if p mL is the volume of 0.02 M potassium permanganate solution necessary to oxidize 1 mL of 3% hydrogen peroxide solution, then for 200 mL of wine use the following calculation:

Bring the volume to about 200 mL by addition of distilled water.

Distill, recover the distillate in a 50 mL glass flask containing 5 mL distilled water, which is immersed in an ice bath; stop the distillation before the measurement line, bring back to ambient temperature and adjust the volume to 50 mL.

c) Add 0.5 mL (measured exactly) of ferric chloride solution, mix and measure immediately (maximum delay 5 min.) the absorbance at 465 nm in a 1 cm

cell; the zero of the apparatus is set using a blank composed of 50 mL of water added to 0.5 mL of ferric chloride solution.

d) Preparation of the standard curve.

Into each of five 50 mL volumetric flasks add 1, 2, 3, 4, and 5 mL of 200 mg/L sodium azide solution respectively, bring the volume to 50 mL with distilled water, add 0.5 mL of ferric chloride solution and measure the absorbance at 465 nm.

These solutions contain 4, 8, 12, 16, 20 mg of sodium azide per liter. The corresponding concentrations are 1, 2, 3, 4, and 5 mg per liter of wine.

The typical curve of absorbance variation as a function of concentration is a straight line passing through the origin.

1.2.5. Calculation

Plot the absorbance read for the sample analyzed on the straight line and interpolate the concentration of sodium azide in mg/L of wine.

Bibliography

HPLC method:

Searin S.J. & Waldo R.A., J. Liquid. Chrom., 1982, 5(4), 597-604.
Battaglia R. & Mitiska J., Z. Lebensm. Unters. Forsch., 1986, 182, 501-502.

Colorimetric method:

Clermont S. & Chretien D., F.V., O.I.V., 1977, n° 627.

Enumerating yeasts of the species Brettanomyces bruxellensis using qPCR (Type-IV)

OIV-MA-AS4-03 Enumerating yeasts of the species Brettanomyces bruxellensis using qPCR

Type IV method

Warning to users

Phenol: All handling procedures involving phenol must be performed under a fume hood and gloves must be worn. All phenol-contaminated residues must be collected in suitable containers.

SYBR Green: This displays a non-zero mutagenicity, but one which is lower than that of ethidium bromide. The precautions for use must nevertheless be adhered to.

Scope of application

This protocol describes a method for enumerating yeasts of the species Brettanomyces bruxellensis in wine in bulk or bottled wines, using real-time qPCR (quantitative polymerase chain reaction) (qPCR). The analysis of wines during AF (alcoholic fermentation) and of musts has not yet been validated.

Definition

The micro-organisms enumerated by this method are Brettanomyces bruxellensis yeasts which have a copy of the target gene

Principle

The PCR technique amplifies, by multiple repetition of an enzymatic reaction, a target DNA (deoxyribonucleic acid) region identified by two primers. The process involves repeating a three-step cycle:

Denaturing the DNA by heating
Hybridization of the primers
Polymerization, carried out by the Taq (Thermophilus aquaticus) polymerase

However, unlike traditional PCR, qPCR can quantify the DNA amplified during the amplification process through the use of a fluorophore.

Until now two regions specific to the species have been used as targets. One region is the encoding gene for the 26S ribosomal RNA (ribonucleic acid) and the other the RAD4 gene [2, 3]. As with the FISH method, PCR is specific to Brettanomyces bruxellensis but has the advantage of being less expensive.

The distinctive feature of qPCR is that it is possible to read, after each amplification cycle, the fluorescence which increases exponentially as the DNA amplification proceeds. Many fluorescence techniques have been developed for this application. The SYBR^®Green fluorophore has been found to be suitable for use with Brettanomyces.

SYBR^® Green fluorophore

This agent fluoresces strongly when it inserts itself non-specifically between the nucleotides in the double-stranded DNA. In contrast, it fluoresces only weakly when unbound. Using this technology, a merged curve can be generated at the end of the amplification that validates the specificity of the reaction.

Internal standard

In order to validate the DNA extraction and amplification stages, an internal standard has been integrated into the method (Lip4 Yarrowia lipolytica).

Reagents and products

All plastic consumables must be autoclaved beforehand to destroy any DNases (deoxyribonucleases), as must the Tris-HCl and TE (Tris EDTA, ethylene diamine tetra-acetic acid) buffer solutions, the ammonium acetate and the ultrapure water ( 18 M). All the aqueous solutions are prepared using ultrapure water (18 M). Some solutions are sterilized in an autoclave (indicated as "autoclaved"). Sterile ultrapure water (18 M) is used, if possible, to prepare any solutions which are not autoclaved. It is not then necessary to work under sterile conditions.

PVPP (eg: ISP Polyclar Super R or Sigma P6755-100G),

Solutions at room temperature: Tris-HCl buffer, 10mM pH8, solution I (Tris-HCl 10mM pH8, EDTA 1mM, NaCl 100mM, SDS 1% (sodium dodecyl sulfate), Triton X-100 2%), TE (Tris-HCl 10 mM pH8, EDTA 1mM) autoclaved, 4M ammonium acetate, absolute ethanol,

Provide one autoclaved, sterilized ultrapure (18 M) water bottle (20mL) per qPCR plate,

Solutions at 4°C: saturated phenol pH8: chloroform: IAA (isoamyl alcohol 24:25:1) and Rnase (ribonuclease) 1 μg/ μL

Suspension at –20°C: internal standard, SYBR Green (e.g. iQ SBYR Green Supermix Bio-Rad 170-8884), primers 4 μM Brett rad3, Brett rad4, YAL-F and YAL-R each one.

Dry bath, set to 37°C.

All handling procedures involving phenol must be performed under a fume hood and gloves must be worn. All phenol-contaminated residues must be collected in suitable containers.

PCR substances	Specifications	CAS Number
4.1 ammonium acetate	>98%	631-61-8
4.2 phenol:chloroform:IAA (24:25:1)	Ultra	136112-00-0
4.3 proteinase K	1215 U/mg proteins (16.6 ng/ml)	39450-01-6
4.4 SDS	>99% Ultra	151-21-3
4.5 Tris base	>99.8% Ultra	77-86-1
4.6 BSA	Molecular biology grade	9048-46-8
4.7 saturated phenol pH 8		108-95-2
4.8 PVPP 360kDa		9003-39-8
4.9 RNase A	70 U/mg in solution	9001-99-4
4.10 TE pH8	Ultra	Tris : 77-86-1 EDTA : 60-00-4
4.11 Primers 25nmol		-

Apparatus

Plastic consumables: 2mL screw-capped microtubes, 1.5 and 1.7mL microtubes, white (10 μL), yellow (200 μL) and blue (1000 μL) pipette tips for micropipettes P20, P200, P1000, P5000, 96-well PCR microplates and optical film, non-powdered gloves

Glass beads (Ø 500 µm)

Bottle (20mL) autoclaved (for ultrapure [18 M] sterilized water, one per qPCR plate),

15 and 50 mL Centrifuge tubes

Equipment:

automatic pipettes (P20, P200, P1000, P5000)
microtube centrifuge
automatic stirrer to split cells (eg. GenieDisruptor)

Thermocycler coupled to a spectrofluorimeter (optical system to detect the fluorescence generated during the real-time PCR reactions)

Magnetic stirrer

Stop watch

dry bath set to 37°C

autoclave

100mL volumetric flasks
50mL volumetric flasks
10mL volumetric flasks
100mL beakers
50mL beakers
10mL beakers

Magnetic stirring bars

Sampling (sample preparation)

6.1. Enumerating the samples:

The samples are removed either directly into bottles for analysis or into pre-sterilized sample flasks.

No interference with the method has been observed from the yeasts tested (including K1 and L2056) when the yeast populations are not greater than 5.10⁶CFU/mL (colony forming units). There is no data for populations larger than this figure; consequently, avoid measuring wines during AF.

NB: When enumerating yeasts using standard microbiology methods of analysis (growth in agar growth medium , optical density), the results are expressed in CFU/mL (colony forming unit). Conversely, enumeration resulting from the analysis by qPCR is expressed in GU/mL (genetic unit).

6.2. Preparing the internal standard

Grow Yarrowia in liquid YPD (yeast peptone dextrose) at 28°C up to an O(optical density at 600 nm)of 1 (approximately 48 hrs).

After estimating the O dilute to 1.0 x 10⁶CFU/mL in isotonic saline solution (1 OD = 1.0 x 10⁷CFU/mL).

Transfer a 110 μL sample of the 1.0 x 10⁶CFU/mL culture into a 1.7mL microtube and add 110 μL of 40 % glycerol to obtain a population of 5.0 x 10⁵CFU/mL. Mix and store at -80°C. One tube can be used to process 5 wine samples.

Perform an enumeration simultaneously to check the titer of the suspension.

6.3. Preparing the solutions

100mL of Tris-HCl pH8 10 mM: weigh 0.121 g of tris base (eg.Trizma base) and dissolve in 80mL of ultrapure [18 M] water. Adjust the pH using HCl. Make up to 100mL. Autoclave.
100mL TE: weigh 0.121 g of tris base and dissolve in 80mL of water. Adjust the pH using HCl. Add 37.2 mg of EDTA. Adjust the pH to 8 (to assist the dissolution of the EDTA) then make up to 100mL. Autoclave.
100mL solution I: prepare 50mL of TE 2x and add 10mL of 1M NaCl, 10mL of SDS 10% (dissolved by heating gently) and 2 g of Triton X100, then make up to volume.
4M ammonium acetate: dissolve 15.4 g of ammonium acetate in 50 mL ultrapure [18 M] water qs to 50mL.
100mL phenol:chloroform:IAA (25:24:1): add 48mL of chloroform and 2mL of isoamyl alcohol to 50mL of phenol saturated with TE buffer pH8. Store at 4°C.
RNase A 1 μg/µL: dilute a 70U/mg solution of RNase A (e.g. Sigma, R4642-50MG, stored at –20°C) with ultrapure [18 M] water. The specified concentration of the RNase stock is indicated on the tube and in the specification sheet for the batch. The diluted solution should be kept at not more than 4°C for up to 3 weeks.
Brett 4 μM primers: using 100 µM stock solutions of primers (in the supplier’s tubes), mix 4 μM Brett rad3 (GTTCACACAATCCCCTCGATCAAC) and 4 μM Brett rad4 (TGCCAACTGCCGAATGTTCTC) qs to 1mL with ultrapure [18 M] water). Store for up to 1 year at –20°C.
YAL 4 μM primers: using 100 µM stock solutions of primers (in the supplier’s tubes), mix 4 µM YAL-F (ACGCATCTGATCCCTACCAAGG) and 4 μM YAL-R (CATCCTGTCGCTCTTCCAGGTT) qs to 1mL with ultrapure [18 M] water). Store for up to 1 year at –20°C.

Procedure

Sample to be analyzed: shake the bottle to homogenize its contents.

For a corked bottle: disinfect the neck of the bottle with 70% alcohol and uncork over a naked flame, using a corkscrew disinfected with 70% alcohol.

Transfer a 15-20mL sample of the wine into a 30-mL, sterile, plastic, single-use bottle.

The steps at which the protocol may be paused are identified by a .

7.1. Separating the cells

This step must be duplicated.

The handling procedures must be carried out under a confined microbiological safety cabinet dedicated to this purpose.

take a 1mL sample of wine and transfer to a 2mL screw-capped microtube

add 20 μL of internal standard, at a concentration of 5.0 x 10⁵CFU/mL

centrifuge for 30 sec. at 9,300g

eliminate the supernatant by gently inverting the microtube

suspend the pellet in 1mL of Tris-HCl 10 mM pH 8

centrifuge for 30 sec. at 9,300g and eliminate the supernatant.

vortex briefly to suspend the pellet in the residual fluid .

One tube will be used for extracting the DNA and the other will be stored at –20°C until validated results have been obtained.

7.2. Extracting the DNA

From a fresh or frozen pellet. Do not process more than 24 samples at the same time.

add PVPP (1% of final mass/volume) by weighing add 0.3 g of 200-500 μm glass beads
add 200 μL of solution I
add 200 μL of phenol:chloroform:IAA (24:25:1)
disrupt the cells with the automatic stirrer (for example a GenieDisruptor) 4x80 sec. with cold intervals (-20°C refrigerated unit) lasting for about 80sec between each disruption phase
add 200 μL of TE
centrifuge for 5min at 15700g.
carefully collect 400 μL of the upper aqueous phase in a 1.7mL microtube. If the two phases mix, repeat the centrifugation step.
add 1mL of absolute ethanol and mix the tube by inversion 4-5 times
centrifuge for 5 minutes at 15700g and eliminate the supernatant by inverting the microtube
suspend the pellet in 400 μL of TE and 30µL of RNase at a concentration of 1 μg/ μL
incubate the solution at 37°C for 5 minutes (then readjust to 48°C)
add 10 μL of 4M ammonium acetate + 1mL of absolute ethanol; mix by inversion
centrifuge for 5 minutes at 15700g
eliminate the supernatant by inversion; use filterpaper to absorb the final drops
dry the pellet (leave the open tube in the dry bath at 48°C, for approximately 1 hour)
add 25 μL of TE to the pellet, vortex and leave at 4°C for between 1 and 18 hrs (to assist the solubilisation of the DNA). Mix using the automatic stirrer
1. qPCR

For each sample of wine, provide 2 wells with Brett rad3/4 primers and 2 internal standard wells with YAL primers. For each plate, provide a negative control with TE for each pair of primers to be carried out as the final operation. Also perform a positive control on the Brettanomyces bruxellensis DNA available at -20°C. To prepare the positive control, add 5 μL stock solution (4.5 UG / ml) in a final reaction volume of 25 μL.

PCR amplification programme:

Cycle number	Time (seconds)	Temperature (°C)
1	180	95
40	30	95
40	10	64.6
The merged curve is established after 90°C by reducing the heat by 0.5°C every 10 seconds

Num. of Brett wells = Num. of YAL wells = 2 x no. of samples + 2

The table below indicates, as a function of the number of samples, the number of wells and the quantity of each constituent of the mixture.

number of samples	number of wells	water at18 M (μL)	iQ SYBR Green Supermix (μL)	Mixture of 4 μM primers (μL)
1	4	26.3	65.6	13.1
2	6	36.8	91.9	18.4
3	8	47.3	118.1	23.6
4	10	57.8	144.4	28.9
5	12	68.3	170.6	34.1
6	14	78.8	196.9	39.4
7	16	89.3	223.1	44.6
8	18	99.8	249.4	49.9
9	20	110.3	275.6	55.1
10	22	120.8	301.9	60.4
11	24	131.3	328.1	65.6
12	26	141.8	354.4	70.9
13	28	152.3	380.6	76.1
14	30	162.8	406.9	81.4
15	32	173.3	433.1	86.6
16	34	183.8	459.4	91.9
17	36	194.3	485.6	97.1
18	38	204.8	511.9	102.4
19	40	215.3	538.1	107.6
20	42	225.8	564.4	112.9
21	44	236.3	590.6	118.1
22	46	246.8	616.9	123.4
23	48	257.3	643.1	128.6

remove the Brett 4 μM and the YAL 4 μM primers from the freezer
remove the SYBR Green (4°C if tube in current use, otherwise –20°C)
prepare a Brett mixture and a YAL mixture using the quantities shown in the table above as a function of the number of samples.
apply 20 μL of mixture to the bottom of each well
add 5 μL of homogenized DNA solution to the automatic stirrer (or 5 μL of water for the negative controls)
adjust the optical film and load the plate
1. Reading the results

remove the plate and place it directly in the bag for disposal (do not open it)

set the baseline to 100.

analyze (in the order indicated below):

the negative controls, which should not produce a signal. If a Ct of less than 37 is observed, repeat the process, changing all the solutions,

the positive control on Brett: its Ct must be approximately 25, with a melting point of 82.5°C ( 0.5°C),

YAL internal standards: if a Ct is obtained, check the melting point of the product (84°C 0.5°C). If the product does not conform, the absence of a Brett signal cannot be interpreted,

samples: check the Tm of the Brettanomyces bruxellensis product (82°C 0.5°C). If and only if the Tm is acceptable, check the exponential profile of the amplification. Then record the Ct values and plot them onto the standard curve.

NB: the Ct represents the time needed for the fluorescence of the target sequence to reach a threshold value. Consequently, it is the minimum number of PCR cycles required for the fluorescent signal to emerge from the background noise.

Calculations (Results)

Five Brettanomyces bruxellensis strains were inoculated at different concentrations, from 3,1 x 10⁵to 3 UFC/mL, on 14 wines (3 white wines, 2 rosé wines, 9 red wines whose phenolic compound content varied widely). The DNA was then extracted in the presence of 1% PVPP

A standard curve was established from the set of results obtained on the different combinations of wines and strains.

The results are obtained in GU/mL (genetic unit/mL) from the standard curve

Method characteristics: intra-laboratory validation parameters

9.1. Linearity, repeatability and reproducibility [4]

The six-point calibration curve was prepared in the range of 0 to 2x10⁵CFU/mL of the L02I1 strain in a wine with four replicates. This population range was selected according to the usual levels of Brettanomyces bruxellensis in wines. The measured log GU vs. theoretical log GU relationship was described by simple regression analysis. Regression parameters, slope and intercept were determined as shown in the Table below. The regression model was accepted with a risk α=1% and the chosen linearity domain validated since no model error was detected.

Fidelity of the method was compared to that obtained with the classical culture method. Three operators prepared DNA extracted from a wine inoculated with the L02I1 strain at two levels: 1.9x10⁴ (high) or 1.9x10² (low) CFU/mL. Four repeats of PCR were performed for each DNA extract. The standard deviation for repeatability and reproducibility, respectively S_rand S_R, were calculated from log GU values for both levels (table below). For the qPCR method, both S_rand S_Rwere similar for the low population level, but S_R was greater than S_r at high population levels. Both standard deviations were twice as high as those obtained with the classical microbiology method. This effect was attributed to the increased number of steps during the qPCR method.

Table

Parameter	Values
Regression equation
Range (CFU/mL)	0 to 2x10⁵
Slope (SD)	0.957 (0.044)
Intercept (SD)	-0.049 (0.142)
Regression model	F_obs>F(1.18) : Linear model accepted
Model error	F_obs<F(4.18) : No model error

Fidelity
qPCR (low/high)	0.26/0.25
microbio (low/high)	0.17/0.04
qPCR (low/high)	0.29/0.41
microbio (low/high)	0.17/0.04

Accuracy
Mean 43 samples (D)	2.39 (qPCR)/2.25 (microbio)
D	1.18
Equality test W=D/S_R D	0.11<3 accuracy acceptable

9.2. Limit of detection (LoD) and limit of quantification (LoQ) [4]

LoD and LoQ indicate the sensitivity of the method. LoD is the lowest population detected by the method; LoQ is the minimum of the population that can be quantified accurately. In food product analysis, these parameters are calculated from the background. However in qPCR there is no

background. We thus used two other approaches to evaluate LoD and LoQ. The first method uses slope, intercept and standard error on intercept obtained from linearity validation experiments. With this method, LoD and LoQ values of 3 and 31 GU/mL respectively were obtained. In the second approach, the LD was obtained from the population level resulting in one negative result from 10 independent measurements. Analysis of our data obtained from 14 wines inoculated with five strains revealed that 96% of samples (48/50) containing 101 to 250 CFU/mL resulted in positive signals, while 83% (49/59) were positive if they contained 26 to 100 CFU/mL and 65% (44/68) if 5 to 25 CFU/mL. Thus the limit of detection evaluated from this method would be in the range of 26-100 CFU/mL. By the systematic repetition of each PCR assay, an LoD of 5 CFU/mL was certified thanks to probability calculations (1 – p)². Indeed for 5 CFU/mL, 88% of samples were positive. This increased to 97% for 25 CFU/mL.

References

Phister T.G., Mills D.A., 2003. Real-time PCR assay for detection and enumeration of Dekkera bruxellensis in wine. Applied and Environmental Microbiology, 69: 7430-7434.
Cocolin L., Rantsiou K., Iacumin L., Zironi R., Comi G., 2003. Molecular detection and identification of Brettanomyces/Dekkera bruxellensis Brettanomyces/Dekkera anomalus in spoiled wines. Applied and Environmental Microbiology, 70: 1347-1355.
Ibeas J.I., Lozano I., Perdigones F., Jimenez J., 1996. Detection of Dekkera-Brettanomyces strains in sherry by a nested PCR method. Applied and Environmental Microbiology, 62: 998-1003.
Tessonnière H., Vidal S., Barnavon L., Alexandre H., Remize F., 2009. Design and performance testing of a real-time PCR assay for sensitive and reliable direct quantification of Brettanomyces in wine. International Journal of Food Microbiology, 129: 237-243.

SECTION 5 - OTHER ANALYSIS

Codified File

Differentiation of fortified musts and sweet fortified wines

OIV-MA-AS5-01 Differentiation of fortified musts and sweet fortified wines

Type IV method

Principle of the method

1.1. Method of screening

The product definitions given by the O.I.V. (International Code of Enological Practices) imposes for fortified wines, a minimum of 4% acquired alcohol derived naturally by fermentation; and allows, for fortified musts, a maximum of 1% acquired alcohol. Consequently, these products may be differentiated by identifying their fermentation by-products via gas chromatography.

This method is applicable only if, as the definition anticipates, the alcohol used for production of the fortified musts is neutral.

1.2. Scientific investigation of citramalic acid by thin layer chromatography.

The presence of citramalic acid characterizes sweet fortified wines. Its identification is carried out by thin layer chromatography after separation of the sugars with the use of an ion exchange column.

Method of screening

2.1. Apparatus

Gas chromatograph with:

Flame ionization detector,
3 m stainless steel column, 2 mm interior diameter,

Stationary phase: Carbowax 20 M 20%,

Support: Chromosorb W 60/80 mesh.

Chromatography conditions:

temperatures:

injector: 210°C
detector: 250°C

oven: isothermal at 70°C for 6 minutes; then programmed at 6°C/minute; upper temperature limit: 170°C

Other types of columns can be used.

The procedure described below is given as an example.

2.2. Procedure

2.2.1. Sample preparation

Carry out a separation according to the following conditions: To 25 mL of sample (fortified must or sweet fortified wine) are added to 7 mL ethanol and 15 g of ammonium sulfate, agitate. Allow to settle to obtain separation of the phases.

2.2.2. Chromatography

Inject 2 μL of the organic phase and carry out the chromatography in accordance with the conditions indicated above.

The chromatogram of the fortified wine is differentiated by the presence of the peaks of the secondary products of alcoholic fermentation.

Investigation of citramalic acid by thin layer chromatography.

3.1. Apparatus

3.1.1. Glass column about 300 mm in length and 10-11 mm interior diameter supplied with a flow regulator (stopcock)

3.1.2. Rotary vacuum evaporator

3.1.3. Oven at 100 °C

3.1.4. Chromatography developing chamber

3.1.5. Micrometric syringe or micropipette

3.2. Reagents

3.2.1. Formic acid solution, 4 M, containing 150.9 mL formic acid (₂₀= 1.227 g/mL) per liter.

3.2.2. Plates for chromatography ready to use with a layer of cellulose powder (for example MN 300) (20 x 20 cm).

3.2.3. Solvent:

iso-Propyl alcohol containing 1 g/L bromophenol blue 5 vol.

Eucalyptol 5 vol.

Formic acid (ρ₂₀= 1.227 g/mL) 2 vol.

Saturate the solvent with water and allow to stand for 24 hours before use.

3.2.4. Standard solutions.

Prepare an aqueous solution of:

citramalic acid 0.25 g/L

Lactic acid 0.5 g/L

citric acid 0.5 g/L

Tartaric acid 1.0 g/L

malic acid 1.0 g/L

3.3. Procedure

3.3.1. Preparation of the ion exchange column.

See chapter on Tartaric acid, usual method in 3.3.1.

3.3.2. Isolation of the organic acid of citramalic acid

Proceed as indicated in the chapter Tartaric acid, usual method in 3.3.2. for the fixation of organic acids on the ion exchanger.

Then elute the fixed acids using the 4 M formic acid solution (100 mL), collecting the eluate in a 100 mL volumetric flask.

Concentrate the eluate dry in a rotary evaporator at 40°C recovering the residue with 1 mL of distilled water.

3.3.3. Chromatography

The cellulose plate must be activated by placing it in the oven at 100°C for 2 hours.

Deposit on the starting line of the cellulose plate in a band 2 cm wide, 10 µL of this solution as well as 10 μL of the standard solutions of citramalic acid and the other organic acids.

Place the plate in the chromatography bath, above the solvent, for 45 minutes.

Proceed with the development and let the solvent migrate to a height of 15 cm.

3.3.4. Development of the chromatogram

Maintain the plate at ambient temperature under an air current, until the formic acid of the solvent is eliminated. Yellow spots appear on a blue background, indicating the presence of the acids.

Detect the presence or absence of citramalic acid in the product analyzed by comparing the spots of this chromatogram to the spots of standard solutions of citramalic acid and the other organic acids.

Bibliography

Method of Screening:

HARVALIA A., F.V., O.I.V., 1980, n° 728 bis.

Chromatography of citramalic acid:

Dimotaki-Kourakou V., Ann. Fals. Exp. Chim., 1960, 53, 149.
Dimotaki-Kourakou V., C. R. Ac. Sci., Paris 1962, 254, 4030.
Carles J., Lamazou-Betbeder M. & PECH M., C. R. Ac. Sci., Paris 1958, 246, 2160.
Castino M., Riv. Vit. Enol., 1967, 6, 247.
Kourakou V., F.V., O.I.V., 1977, n° 642.
Junge Ch F.V., O.I.V., 1978, n° 679.
Rouen J., F.V., O.I.V., 1979, n° 691.

Annex A - Methods of Analysis of Wines and Musts

Standards

OIV-MA-AS1-02 General remarks

OIV-MA-AS1-03 Classification of analytical methods

OIV-MA-AS1-04 Matrix effect for metals content analysis using atomic absorption

OIV-MA-AS1-05a Provisions on the use of proprietary methods that should be adopted by the OIV

OIV-MA-AS2-01 Density and specific gravity at 20°C

OIV-MA-AS2-02 Évaluation by refractometry of the sugar concentration in grape musts, concentrated grape musts and rectified concentrated grape musts

OIV-MA-AS2-03A Total dry matter

OIV-MA-AS2-03B Total dry matter

OIV-MA-AS2-04 Ash

OIV-MA-AS2-05 Alkalinity of ash

OIV-MA-AS2-06 Measurement of the oxidation-reduction potential in wines

OIV-MA-AS2-07B Chromatic characteristics

OIV-MA-AS2-08 Wine turbidity (Determination by Nephelometric Analysis)

OIV-MA-AS2-10 Folin Ciocalteu Index

OIV-MA-AS2-11 Determination of chromatic characteristics according to CIELab

OIV-MA-AS2-12 Method for isotope ratio determination of water in wines and must

OIV-MA-AS4-01 Microbiological analysis of wines and musts- Detection, differentiation and counting of micro-organisms

OIV-MA-AS4-02A Detection of preservatives and fermentation inhibitors

OIV-MA-AS4-02B Detection of preservatives and fermentation inhibitors

OIV-MA-AS4-02C Detection of preservatives and fermentation inhibitors

OIV-MA-AS4-02D Detection of preservatives and fermentation inhibitors

OIV-MA-AS4-02E Detection of preservatives and fermentation inhibitors

OIV-MA-AS4-02F Detection of preservatives and fermentation inhibitors

OIV-MA-AS4-03 Enumerating yeasts of the species Brettanomyces bruxellensis using qPCR

OIV-MA-AS5-01 Differentiation of fortified musts and sweet fortified wines